Mutagenetix > Incidental Mutations

Incidental Mutation 'K7894:Vmn1r58'

26517

Institutional Source

Beutler Lab

Gene Symbol

Vmn1r58

Ensembl Gene

ENSMUSG00000078808

Gene Name

vomeronasal 1 receptor 58

Synonyms

V3R4, V1rd4

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

K7894 () of strain 468

Quality Score

222

Status

Validated (trace)

Chromosome

Chromosomal Location

5401681-5413396 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5410703 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 176 (N176S)

Ref Sequence

ENSEMBL: ENSMUSP00000154393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108569] [ENSMUST00000228728]

Predicted Effect

probably benign
Transcript: ENSMUST00000108569
AA Change: N176S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000104209
Gene: ENSMUSG00000078808
AA Change: N176S

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	296	7.8e-13	PFAM
Pfam:7tm_1	20	279	4.4e-7	PFAM
Pfam:V1R	31	296	7.7e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209136

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226315

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227549

Predicted Effect

probably benign
Transcript: ENSMUST00000228728
AA Change: N176S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 95.4%

Validation Efficiency

88% (22/25)

Allele List at MGI

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	C	CAA	3: 122,147,868		probably null	Het
Acsl4	C	T	X: 142,328,060	V632I	probably benign	Het
Adcy8	T	C	15: 64,822,234	H398R	probably benign	Het
Catsperg1	C	T	7: 29,197,154		probably benign	Het
Ccpg1	T	C	9: 73,001,877		probably null	Het
Clk4	G	T	11: 51,275,766		probably benign	Het
Ehbp1	C	T	11: 22,089,683		probably benign	Het
Eri2	T	C	7: 119,785,271	D669G	probably benign	Het
Nlrp9c	A	G	7: 26,384,898	S419P	possibly damaging	Het
Olfr652	A	G	7: 104,564,532	T104A	probably benign	Het
Pde8a	C	A	7: 81,306,765	P304H	probably damaging	Het
Prmt3	A	G	7: 49,826,711	Y356C	probably damaging	Het
Rsph10b	A	G	5: 143,944,520	D151G	probably damaging	Het
Spryd3	A	G	15: 102,118,141	V365A	probably benign	Het

Other mutations in Vmn1r58

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01287:Vmn1r58	APN	7	5411055	missense	probably benign	0.19
IGL02792:Vmn1r58	APN	7	5411229	start codon destroyed	probably null	0.04
IGL03215:Vmn1r58	APN	7	5410836	missense	probably benign	0.00
IGL03259:Vmn1r58	APN	7	5411087	nonsense	probably null
R0033:Vmn1r58	UTSW	7	5410388	missense	probably damaging	1.00
R0225:Vmn1r58	UTSW	7	5410866	missense	probably benign	0.02
R0304:Vmn1r58	UTSW	7	5410496	missense	probably damaging	1.00
R0360:Vmn1r58	UTSW	7	5410330	missense	probably benign	0.25
R0363:Vmn1r58	UTSW	7	5410637	missense	probably damaging	1.00
R0454:Vmn1r58	UTSW	7	5410998	missense	possibly damaging	0.69
R0565:Vmn1r58	UTSW	7	5411166	missense	probably benign	0.06
R0612:Vmn1r58	UTSW	7	5410619	missense	probably damaging	1.00
R0646:Vmn1r58	UTSW	7	5410677	missense	probably benign	0.00
R0853:Vmn1r58	UTSW	7	5410325	missense	probably damaging	1.00
R0920:Vmn1r58	UTSW	7	5410789	missense	probably benign	0.00
R1696:Vmn1r58	UTSW	7	5410728	missense	possibly damaging	0.67
R1823:Vmn1r58	UTSW	7	5410406	missense	possibly damaging	0.95
R2326:Vmn1r58	UTSW	7	5410940	missense	probably damaging	1.00
R4088:Vmn1r58	UTSW	7	5410655	missense	probably damaging	1.00
R5065:Vmn1r58	UTSW	7	5410835	missense	probably benign	0.00
R5087:Vmn1r58	UTSW	7	5410667	missense	probably benign	0.04
R5407:Vmn1r58	UTSW	7	5410873	missense	probably benign	0.01
R6855:Vmn1r58	UTSW	7	5410452	missense	possibly damaging	0.56
R7052:Vmn1r58	UTSW	7	5411135	missense	probably benign	0.04
R7334:Vmn1r58	UTSW	7	5411067	missense	probably benign	0.04
R7763:Vmn1r58	UTSW	7	5410913	missense	probably damaging	1.00
R7840:Vmn1r58	UTSW	7	5411243	start gained	probably benign
R7875:Vmn1r58	UTSW	7	5410754	missense	probably damaging	0.98
R8004:Vmn1r58	UTSW	7	5410507	nonsense	probably null
R8115:Vmn1r58	UTSW	7	5410342	missense	probably benign	0.00
X0058:Vmn1r58	UTSW	7	5410395	missense	possibly damaging	0.89
Z1176:Vmn1r58	UTSW	7	5410904	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTGGCATACCTCAACCAGAGACG -3'
(R):5'- GGAAGCCTCCAACTGACCTCAAATG -3'

Sequencing Primer
(F):5'- TGTGACCACCAGCATCAGG -3'
(R):5'- GAGGCACAATCATGTGCTC -3'

Posted On

2013-04-16