Incidental Mutation 'K7894:Vmn1r58'
ID26517
Institutional Source Beutler Lab
Gene Symbol Vmn1r58
Ensembl Gene ENSMUSG00000078808
Gene Namevomeronasal 1 receptor 58
SynonymsV3R4, V1rd4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #K7894 () of strain 468
Quality Score222
Status Validated (trace)
Chromosome7
Chromosomal Location5401681-5413396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5410703 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 176 (N176S)
Ref Sequence ENSEMBL: ENSMUSP00000154393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108569] [ENSMUST00000228728]
Predicted Effect probably benign
Transcript: ENSMUST00000108569
AA Change: N176S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000104209
Gene: ENSMUSG00000078808
AA Change: N176S

DomainStartEndE-ValueType
Pfam:TAS2R 1 296 7.8e-13 PFAM
Pfam:7tm_1 20 279 4.4e-7 PFAM
Pfam:V1R 31 296 7.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227549
Predicted Effect probably benign
Transcript: ENSMUST00000228728
AA Change: N176S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.4%
Validation Efficiency 88% (22/25)
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C CAA 3: 122,147,868 probably null Het
Acsl4 C T X: 142,328,060 V632I probably benign Het
Adcy8 T C 15: 64,822,234 H398R probably benign Het
Catsperg1 C T 7: 29,197,154 probably benign Het
Ccpg1 T C 9: 73,001,877 probably null Het
Clk4 G T 11: 51,275,766 probably benign Het
Ehbp1 C T 11: 22,089,683 probably benign Het
Eri2 T C 7: 119,785,271 D669G probably benign Het
Nlrp9c A G 7: 26,384,898 S419P possibly damaging Het
Olfr652 A G 7: 104,564,532 T104A probably benign Het
Pde8a C A 7: 81,306,765 P304H probably damaging Het
Prmt3 A G 7: 49,826,711 Y356C probably damaging Het
Rsph10b A G 5: 143,944,520 D151G probably damaging Het
Spryd3 A G 15: 102,118,141 V365A probably benign Het
Other mutations in Vmn1r58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Vmn1r58 APN 7 5411055 missense probably benign 0.19
IGL02792:Vmn1r58 APN 7 5411229 start codon destroyed probably null 0.04
IGL03215:Vmn1r58 APN 7 5410836 missense probably benign 0.00
IGL03259:Vmn1r58 APN 7 5411087 nonsense probably null
R0033:Vmn1r58 UTSW 7 5410388 missense probably damaging 1.00
R0225:Vmn1r58 UTSW 7 5410866 missense probably benign 0.02
R0304:Vmn1r58 UTSW 7 5410496 missense probably damaging 1.00
R0360:Vmn1r58 UTSW 7 5410330 missense probably benign 0.25
R0363:Vmn1r58 UTSW 7 5410637 missense probably damaging 1.00
R0454:Vmn1r58 UTSW 7 5410998 missense possibly damaging 0.69
R0565:Vmn1r58 UTSW 7 5411166 missense probably benign 0.06
R0612:Vmn1r58 UTSW 7 5410619 missense probably damaging 1.00
R0646:Vmn1r58 UTSW 7 5410677 missense probably benign 0.00
R0853:Vmn1r58 UTSW 7 5410325 missense probably damaging 1.00
R0920:Vmn1r58 UTSW 7 5410789 missense probably benign 0.00
R1696:Vmn1r58 UTSW 7 5410728 missense possibly damaging 0.67
R1823:Vmn1r58 UTSW 7 5410406 missense possibly damaging 0.95
R2326:Vmn1r58 UTSW 7 5410940 missense probably damaging 1.00
R4088:Vmn1r58 UTSW 7 5410655 missense probably damaging 1.00
R5065:Vmn1r58 UTSW 7 5410835 missense probably benign 0.00
R5087:Vmn1r58 UTSW 7 5410667 missense probably benign 0.04
R5407:Vmn1r58 UTSW 7 5410873 missense probably benign 0.01
R6855:Vmn1r58 UTSW 7 5410452 missense possibly damaging 0.56
R7052:Vmn1r58 UTSW 7 5411135 missense probably benign 0.04
R7334:Vmn1r58 UTSW 7 5411067 missense probably benign 0.04
R7763:Vmn1r58 UTSW 7 5410913 missense probably damaging 1.00
R7840:Vmn1r58 UTSW 7 5411243 start gained probably benign
R7875:Vmn1r58 UTSW 7 5410754 missense probably damaging 0.98
R8004:Vmn1r58 UTSW 7 5410507 nonsense probably null
R8115:Vmn1r58 UTSW 7 5410342 missense probably benign 0.00
X0058:Vmn1r58 UTSW 7 5410395 missense possibly damaging 0.89
Z1176:Vmn1r58 UTSW 7 5410904 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGGCATACCTCAACCAGAGACG -3'
(R):5'- GGAAGCCTCCAACTGACCTCAAATG -3'

Sequencing Primer
(F):5'- TGTGACCACCAGCATCAGG -3'
(R):5'- GAGGCACAATCATGTGCTC -3'
Posted On2013-04-16