Incidental Mutation 'R3056:Abca1'
ID265170
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene NameATP-binding cassette, sub-family A (ABC1), member 1
SynonymsABC1
MMRRC Submission 040565-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3056 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location53030787-53159895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53127626 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 131 (M131K)
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010]
Predicted Effect probably benign
Transcript: ENSMUST00000030010
AA Change: M131K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: M131K

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,457,283 probably null Het
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Asb14 A G 14: 26,914,189 I510V possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Gpatch11 A G 17: 78,843,843 T228A probably damaging Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1087 C A 2: 86,690,552 C141F possibly damaging Het
Olfr1163 T A 2: 88,071,239 T48S probably benign Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Pccb C T 9: 101,030,197 R79Q probably damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn2r110 T A 17: 20,583,098 Y405F probably damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53059255 critical splice donor site probably null
IGL00778:Abca1 APN 4 53086132 missense probably benign
IGL01013:Abca1 APN 4 53038185 nonsense probably null
IGL01510:Abca1 APN 4 53143979 missense probably damaging 0.97
IGL01608:Abca1 APN 4 53038158 missense probably damaging 1.00
IGL01845:Abca1 APN 4 53090297 missense probably damaging 1.00
IGL02048:Abca1 APN 4 53069831 missense probably damaging 1.00
IGL02249:Abca1 APN 4 53068739 nonsense probably null
IGL02569:Abca1 APN 4 53034061 missense probably damaging 1.00
IGL02622:Abca1 APN 4 53034046 missense probably damaging 0.99
R6720_abca1_529 UTSW 4 53083733 missense probably damaging 1.00
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0050:Abca1 UTSW 4 53069910 splice site probably benign
R0107:Abca1 UTSW 4 53080834 missense probably benign 0.00
R0127:Abca1 UTSW 4 53067155 missense probably benign 0.00
R0178:Abca1 UTSW 4 53081953 missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53086039 missense probably damaging 0.97
R0267:Abca1 UTSW 4 53046105 missense probably damaging 1.00
R0269:Abca1 UTSW 4 53044228 missense probably benign
R0586:Abca1 UTSW 4 53092860 missense probably benign 0.00
R0587:Abca1 UTSW 4 53107035 missense probably benign 0.00
R1403:Abca1 UTSW 4 53059253 splice site probably benign
R1404:Abca1 UTSW 4 53059253 splice site probably benign
R1405:Abca1 UTSW 4 53059253 splice site probably benign
R1558:Abca1 UTSW 4 53092887 missense probably null 0.00
R1655:Abca1 UTSW 4 53050964 missense probably benign
R1662:Abca1 UTSW 4 53090251 splice site probably null
R1769:Abca1 UTSW 4 53074325 missense probably damaging 1.00
R1898:Abca1 UTSW 4 53071977 missense probably benign 0.08
R1945:Abca1 UTSW 4 53061509 frame shift probably null
R1966:Abca1 UTSW 4 53050409 missense probably damaging 1.00
R2055:Abca1 UTSW 4 53069881 missense probably benign
R2185:Abca1 UTSW 4 53089830 missense probably benign 0.12
R2202:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2203:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2204:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R3849:Abca1 UTSW 4 53061481 splice site probably benign
R3850:Abca1 UTSW 4 53061481 splice site probably benign
R3906:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53044144 missense probably damaging 1.00
R4204:Abca1 UTSW 4 53090369 missense probably benign 0.00
R4225:Abca1 UTSW 4 53085106 missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53062568 missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53085092 splice site probably null
R5022:Abca1 UTSW 4 53041570 frame shift probably null
R5168:Abca1 UTSW 4 53086070 missense probably benign
R5363:Abca1 UTSW 4 53132963 missense probably benign 0.00
R5439:Abca1 UTSW 4 53042381 missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53067168 splice site probably null
R5614:Abca1 UTSW 4 53046132 missense probably damaging 1.00
R5810:Abca1 UTSW 4 53079631 missense probably benign
R6001:Abca1 UTSW 4 53075555 missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53085261 missense probably benign
R6185:Abca1 UTSW 4 53078089 missense probably benign 0.31
R6262:Abca1 UTSW 4 53092917 missense probably benign 0.01
R6455:Abca1 UTSW 4 53042376 missense probably damaging 0.98
R6472:Abca1 UTSW 4 53085991 critical splice donor site probably null
R6564:Abca1 UTSW 4 53034031 missense possibly damaging 0.85
R6720:Abca1 UTSW 4 53083733 missense probably damaging 1.00
R6903:Abca1 UTSW 4 53143952 missense probably benign 0.17
R6960:Abca1 UTSW 4 53072924 missense probably benign 0.00
R7065:Abca1 UTSW 4 53074233 missense probably damaging 0.98
R7142:Abca1 UTSW 4 53082050 missense probably damaging 1.00
R7322:Abca1 UTSW 4 53067151 missense probably damaging 0.97
R7520:Abca1 UTSW 4 53078114 missense probably benign
R7547:Abca1 UTSW 4 53109269 missense probably benign 0.02
R7793:Abca1 UTSW 4 53042367 missense not run
RF005:Abca1 UTSW 4 53049125 missense probably damaging 0.97
RF024:Abca1 UTSW 4 53049125 missense probably damaging 0.97
X0023:Abca1 UTSW 4 53049038 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAAGCAAGCCTGTGCCATTC -3'
(R):5'- CCCTGGAGGATGGAGTAATAGC -3'

Sequencing Primer
(F):5'- ATTCCTGCTGGGGTCTGCATC -3'
(R):5'- CTGGAGGATGGAGTAATAGCTAGGG -3'
Posted On2015-02-05