Incidental Mutation 'R3056:Gm436'
ID265171
Institutional Source Beutler Lab
Gene Symbol Gm436
Ensembl Gene ENSMUSG00000078505
Gene Namepredicted gene 436
SynonymsLOC230890
MMRRC Submission 040565-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R3056 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location144669937-144686368 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144674698 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 72 (I72T)
Ref Sequence ENSEMBL: ENSMUSP00000101373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105747]
Predicted Effect probably benign
Transcript: ENSMUST00000105747
AA Change: I72T

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101373
Gene: ENSMUSG00000078505
AA Change: I72T

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Abhydrolase_3 115 285 1.6e-29 PFAM
Pfam:Abhydrolase_3 292 381 9e-12 PFAM
Meta Mutation Damage Score 0.1241 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,457,283 probably null Het
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Abca1 A T 4: 53,127,626 M131K probably benign Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Asb14 A G 14: 26,914,189 I510V possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gpatch11 A G 17: 78,843,843 T228A probably damaging Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1087 C A 2: 86,690,552 C141F possibly damaging Het
Olfr1163 T A 2: 88,071,239 T48S probably benign Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Pccb C T 9: 101,030,197 R79Q probably damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn2r110 T A 17: 20,583,098 Y405F probably damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Other mutations in Gm436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Gm436 APN 4 144673779 missense probably benign 0.12
IGL01369:Gm436 APN 4 144674645 missense possibly damaging 0.50
IGL01503:Gm436 APN 4 144674567 missense probably damaging 0.99
IGL01505:Gm436 APN 4 144674618 missense probably damaging 1.00
IGL01954:Gm436 APN 4 144670171 missense probably damaging 1.00
IGL02447:Gm436 APN 4 144674699 missense probably benign 0.02
IGL02804:Gm436 APN 4 144670439 missense possibly damaging 0.95
R0373:Gm436 UTSW 4 144686220 missense possibly damaging 0.54
R1124:Gm436 UTSW 4 144670275 missense probably benign 0.00
R1598:Gm436 UTSW 4 144670424 missense possibly damaging 0.60
R1734:Gm436 UTSW 4 144670026 missense probably benign 0.04
R1763:Gm436 UTSW 4 144669959 missense probably benign 0.24
R1968:Gm436 UTSW 4 144670623 missense possibly damaging 0.83
R3055:Gm436 UTSW 4 144674698 missense probably benign 0.16
R3930:Gm436 UTSW 4 144670128 missense probably damaging 1.00
R5124:Gm436 UTSW 4 144674719 missense probably damaging 1.00
R5407:Gm436 UTSW 4 144670325 missense probably benign 0.01
R6302:Gm436 UTSW 4 144670190 nonsense probably null
R6814:Gm436 UTSW 4 144670646 nonsense probably null
R6872:Gm436 UTSW 4 144670646 nonsense probably null
R6988:Gm436 UTSW 4 144686325 missense probably benign 0.01
R7131:Gm436 UTSW 4 144670067 missense probably damaging 0.98
R7895:Gm436 UTSW 4 144670343 missense possibly damaging 0.95
R7978:Gm436 UTSW 4 144670343 missense possibly damaging 0.95
R8108:Gm436 UTSW 4 144670669 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGGCTACCAAAAGCTGCAG -3'
(R):5'- AGAAGAAAAGTATGAACTGCCTTCC -3'

Sequencing Primer
(F):5'- GCCCCTCCATGGTAGAAGATGATG -3'
(R):5'- TATGCCCATGAGATCAGTGC -3'
Posted On2015-02-05