Incidental Mutation 'R3056:Mrpl20'
ID265173
Institutional Source Beutler Lab
Gene Symbol Mrpl20
Ensembl Gene ENSMUSG00000029066
Gene Namemitochondrial ribosomal protein L20
Synonyms2610008D01Rik, 4930425I20Rik
MMRRC Submission 040565-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R3056 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155802878-155809975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 155803872 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 43 (V43F)
Ref Sequence ENSEMBL: ENSMUSP00000139007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030942] [ENSMUST00000105593] [ENSMUST00000130188] [ENSMUST00000137487] [ENSMUST00000185148]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030942
AA Change: V43F

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030942
Gene: ENSMUSG00000029066
AA Change: V43F

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 11 116 2.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105593
SMART Domains Protein: ENSMUSP00000101218
Gene: ENSMUSG00000078487

DomainStartEndE-ValueType
ANK 32 61 2.32e2 SMART
ANK 65 94 1.31e-4 SMART
ANK 98 127 2.16e-5 SMART
ANK 165 195 2.47e0 SMART
low complexity region 205 215 N/A INTRINSIC
low complexity region 225 237 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130188
AA Change: V43F

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139007
Gene: ENSMUSG00000029066
AA Change: V43F

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 10 94 6.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137487
AA Change: V43F

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139122
Gene: ENSMUSG00000029066
AA Change: V43F

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 10 116 1.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184339
Predicted Effect probably benign
Transcript: ENSMUST00000185148
SMART Domains Protein: ENSMUSP00000139169
Gene: ENSMUSG00000029066

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 10 79 1.5e-21 PFAM
Meta Mutation Damage Score 0.1136 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found on chromosome 21q. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,457,283 probably null Het
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Abca1 A T 4: 53,127,626 M131K probably benign Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Asb14 A G 14: 26,914,189 I510V possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Gpatch11 A G 17: 78,843,843 T228A probably damaging Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1087 C A 2: 86,690,552 C141F possibly damaging Het
Olfr1163 T A 2: 88,071,239 T48S probably benign Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Pccb C T 9: 101,030,197 R79Q probably damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn2r110 T A 17: 20,583,098 Y405F probably damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Other mutations in Mrpl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Mrpl20 APN 4 155808584 missense probably benign 0.00
R3055:Mrpl20 UTSW 4 155803872 missense possibly damaging 0.89
R4082:Mrpl20 UTSW 4 155808513 missense probably damaging 0.99
R4846:Mrpl20 UTSW 4 155808536 missense possibly damaging 0.85
R5305:Mrpl20 UTSW 4 155803705 missense probably damaging 1.00
R5779:Mrpl20 UTSW 4 155806921 missense probably damaging 1.00
R6576:Mrpl20 UTSW 4 155806914 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCATGGTCTTCCTCACGACG -3'
(R):5'- CAACATCCTGCGGCTACAGAAG -3'

Sequencing Primer
(F):5'- GGAACCGCCTCACCGATC -3'
(R):5'- CTACAGAAGGCTAAGCTCCGG -3'
Posted On2015-02-05