Incidental Mutation 'R3056:Cntn5'
ID265178
Institutional Source Beutler Lab
Gene Symbol Cntn5
Ensembl Gene ENSMUSG00000039488
Gene Namecontactin 5
SynonymsNB-2, LOC244683, 6720426O10Rik, A830025P08Rik
MMRRC Submission 040565-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3056 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location9660891-10904775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10419071 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 7 (L7P)
Ref Sequence ENSEMBL: ENSMUSP00000135903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074133] [ENSMUST00000160216] [ENSMUST00000162484] [ENSMUST00000179049]
Predicted Effect probably benign
Transcript: ENSMUST00000074133
AA Change: L7P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073769
Gene: ENSMUSG00000039488
AA Change: L7P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160216
AA Change: L7P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124327
Gene: ENSMUSG00000039488
AA Change: L7P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162484
AA Change: L7P

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124214
Gene: ENSMUSG00000039488
AA Change: L7P

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179049
AA Change: L7P

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135903
Gene: ENSMUSG00000039488
AA Change: L7P

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily, and contactin family, which mediate cell surface interactions during nervous system development. This protein is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile, and less susceptible to audiogenic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,457,283 probably null Het
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Abca1 A T 4: 53,127,626 M131K probably benign Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Asb14 A G 14: 26,914,189 I510V possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Gpatch11 A G 17: 78,843,843 T228A probably damaging Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1087 C A 2: 86,690,552 C141F possibly damaging Het
Olfr1163 T A 2: 88,071,239 T48S probably benign Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Pccb C T 9: 101,030,197 R79Q probably damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn2r110 T A 17: 20,583,098 Y405F probably damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Other mutations in Cntn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cntn5 APN 9 9976297 missense probably damaging 0.99
IGL01118:Cntn5 APN 9 9831560 missense possibly damaging 0.94
IGL01328:Cntn5 APN 9 9781768 missense probably damaging 1.00
IGL01445:Cntn5 APN 9 9693484 splice site probably benign
IGL01505:Cntn5 APN 9 9706087 missense probably damaging 1.00
IGL01556:Cntn5 APN 9 9673908 missense probably benign
IGL01804:Cntn5 APN 9 9831537 missense probably damaging 0.99
IGL02173:Cntn5 APN 9 9748396 missense probably damaging 1.00
IGL02250:Cntn5 APN 9 10145331 missense probably damaging 1.00
IGL02366:Cntn5 APN 9 9984055 splice site probably benign
IGL02565:Cntn5 APN 9 10145338 nonsense probably null
IGL02593:Cntn5 APN 9 9833499 missense probably damaging 1.00
IGL02743:Cntn5 APN 9 9984110 missense probably damaging 1.00
IGL02976:Cntn5 APN 9 10419099 unclassified probably benign
IGL03103:Cntn5 APN 9 9972812 splice site probably benign
IGL03114:Cntn5 APN 9 9748452 missense probably damaging 1.00
IGL03156:Cntn5 APN 9 9673877 missense probably damaging 1.00
IGL02802:Cntn5 UTSW 9 10048678 splice site probably null
R0243:Cntn5 UTSW 9 9781775 missense probably damaging 1.00
R0385:Cntn5 UTSW 9 9972870 missense probably damaging 1.00
R0541:Cntn5 UTSW 9 9673402 splice site probably benign
R0827:Cntn5 UTSW 9 9666938 missense possibly damaging 0.88
R1029:Cntn5 UTSW 9 9831572 missense probably damaging 1.00
R1440:Cntn5 UTSW 9 10145339 missense probably damaging 1.00
R1463:Cntn5 UTSW 9 9673796 critical splice donor site probably null
R1536:Cntn5 UTSW 9 9976316 missense possibly damaging 0.78
R1746:Cntn5 UTSW 9 9831572 missense probably damaging 1.00
R1761:Cntn5 UTSW 9 10172054 missense probably benign 0.01
R1764:Cntn5 UTSW 9 9673983 missense probably benign
R1859:Cntn5 UTSW 9 9972834 missense probably damaging 1.00
R1888:Cntn5 UTSW 9 9984077 missense possibly damaging 0.95
R1888:Cntn5 UTSW 9 9984077 missense possibly damaging 0.95
R1950:Cntn5 UTSW 9 9781769 missense probably damaging 1.00
R2143:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2145:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2437:Cntn5 UTSW 9 10048753 nonsense probably null
R2440:Cntn5 UTSW 9 10171955 missense possibly damaging 0.91
R2504:Cntn5 UTSW 9 10172121 missense probably benign
R3054:Cntn5 UTSW 9 10419071 missense probably benign 0.30
R3804:Cntn5 UTSW 9 9781663 splice site probably benign
R4164:Cntn5 UTSW 9 9781676 missense probably damaging 1.00
R4444:Cntn5 UTSW 9 9704942 missense probably damaging 1.00
R4472:Cntn5 UTSW 9 10048771 missense probably damaging 1.00
R4576:Cntn5 UTSW 9 9673292 missense probably benign 0.10
R4624:Cntn5 UTSW 9 9704804 nonsense probably null
R4652:Cntn5 UTSW 9 9704912 missense possibly damaging 0.68
R4664:Cntn5 UTSW 9 10144209 missense possibly damaging 0.71
R4679:Cntn5 UTSW 9 9970531 missense probably benign 0.09
R4829:Cntn5 UTSW 9 9976283 missense probably damaging 1.00
R4929:Cntn5 UTSW 9 9976395 critical splice acceptor site probably null
R5211:Cntn5 UTSW 9 9704889 missense possibly damaging 0.88
R5406:Cntn5 UTSW 9 9833460 missense probably damaging 1.00
R5468:Cntn5 UTSW 9 9743628 missense probably damaging 1.00
R5584:Cntn5 UTSW 9 9661452 missense possibly damaging 0.91
R5688:Cntn5 UTSW 9 9748422 missense probably damaging 1.00
R5762:Cntn5 UTSW 9 9748389 missense possibly damaging 0.95
R6141:Cntn5 UTSW 9 10144157 missense probably benign
R6147:Cntn5 UTSW 9 10012889 missense probably damaging 0.98
R6325:Cntn5 UTSW 9 10144323 intron probably null
R6377:Cntn5 UTSW 9 9743652 missense probably damaging 1.00
R6774:Cntn5 UTSW 9 10144217 missense probably damaging 1.00
R7117:Cntn5 UTSW 9 10904699 start gained probably benign
R7252:Cntn5 UTSW 9 9831635 missense probably benign 0.00
R7363:Cntn5 UTSW 9 10172016 missense probably benign 0.00
R7401:Cntn5 UTSW 9 9833461 missense probably benign 0.13
R7488:Cntn5 UTSW 9 9970565 missense probably damaging 0.99
R7548:Cntn5 UTSW 9 9673410 intron probably null
R7662:Cntn5 UTSW 9 9661385 missense probably benign 0.17
R7718:Cntn5 UTSW 9 9984128 missense probably benign
R7719:Cntn5 UTSW 9 9704898 missense probably damaging 1.00
R7788:Cntn5 UTSW 9 9704929 missense probably benign 0.01
R7864:Cntn5 UTSW 9 9984177 missense probably damaging 0.98
R7947:Cntn5 UTSW 9 9984177 missense probably damaging 0.98
R8117:Cntn5 UTSW 9 9673950 missense probably benign 0.33
Z1177:Cntn5 UTSW 9 9673962 nonsense probably null
Z1177:Cntn5 UTSW 9 10090236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAAGCTTCTGAAGGCTAATAATG -3'
(R):5'- CTGTGCACTTAAAGTTCTGGGTAATG -3'

Sequencing Primer
(F):5'- CAGTGTTGGCAAGGTTGTTTAGTTC -3'
(R):5'- TGATATGAGATTTTGCAGGGAAGC -3'
Posted On2015-02-05