Incidental Mutation 'R3056:Timm29'
ID265180
Institutional Source Beutler Lab
Gene Symbol Timm29
Ensembl Gene ENSMUSG00000048429
Gene Nametranslocase of inner mitochondrial membrane 29
Synonyms1810026J23Rik
MMRRC Submission 040565-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R3056 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21592722-21595970 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21593591 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 185 (M185T)
Ref Sequence ENSEMBL: ENSMUSP00000058283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034700] [ENSMUST00000034703] [ENSMUST00000062125] [ENSMUST00000078572] [ENSMUST00000115394] [ENSMUST00000115395] [ENSMUST00000130032] [ENSMUST00000180365] [ENSMUST00000213809]
Predicted Effect probably benign
Transcript: ENSMUST00000034700
SMART Domains Protein: ENSMUSP00000034700
Gene: ENSMUSG00000032182

DomainStartEndE-ValueType
Pfam:Yip1 84 272 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034703
SMART Domains Protein: ENSMUSP00000034703
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.1e-71 PFAM
Pfam:PRMT5 144 447 2.3e-16 PFAM
Pfam:MTS 166 308 2.7e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 173 287 2.2e-12 PFAM
Pfam:Methyltransf_31 183 325 7.4e-11 PFAM
Pfam:Methyltransf_18 185 290 5.1e-12 PFAM
Pfam:Methyltransf_26 186 287 5.3e-10 PFAM
Pfam:Methyltransf_11 190 287 8.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 562 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000062125
AA Change: M185T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058283
Gene: ENSMUSG00000048429
AA Change: M185T

DomainStartEndE-ValueType
Pfam:DUF2366 26 192 2.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078572
SMART Domains Protein: ENSMUSP00000077649
Gene: ENSMUSG00000032182

DomainStartEndE-ValueType
Pfam:Yip1 84 272 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115394
SMART Domains Protein: ENSMUSP00000111052
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 29 140 4.7e-63 PFAM
Pfam:PRMT5 145 447 4.1e-16 PFAM
Pfam:Methyltransf_9 168 318 1.4e-9 PFAM
Pfam:MTS 170 299 2.5e-9 PFAM
Pfam:PrmA 175 287 3.7e-12 PFAM
Pfam:Methyltransf_31 183 326 1.9e-10 PFAM
Pfam:Methyltransf_18 185 290 4e-9 PFAM
Pfam:Methyltransf_11 190 287 6.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115395
SMART Domains Protein: ENSMUSP00000111053
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2e-71 PFAM
Pfam:PRMT5 144 447 2.1e-16 PFAM
Pfam:MTS 166 308 2.6e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 172 287 2.1e-12 PFAM
Pfam:Methyltransf_31 183 326 6.9e-11 PFAM
Pfam:Methyltransf_18 185 290 4.8e-12 PFAM
Pfam:Methyltransf_26 186 287 5e-10 PFAM
Pfam:Methyltransf_11 190 287 8.1e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130032
SMART Domains Protein: ENSMUSP00000117243
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.8e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154049
Predicted Effect probably benign
Transcript: ENSMUST00000180365
SMART Domains Protein: ENSMUSP00000136463
Gene: ENSMUSG00000032182

DomainStartEndE-ValueType
Pfam:Yip1 84 272 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213809
Predicted Effect probably benign
Transcript: ENSMUST00000216160
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,457,283 probably null Het
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Abca1 A T 4: 53,127,626 M131K probably benign Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Asb14 A G 14: 26,914,189 I510V possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Gpatch11 A G 17: 78,843,843 T228A probably damaging Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1087 C A 2: 86,690,552 C141F possibly damaging Het
Olfr1163 T A 2: 88,071,239 T48S probably benign Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Pccb C T 9: 101,030,197 R79Q probably damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn2r110 T A 17: 20,583,098 Y405F probably damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Other mutations in Timm29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Timm29 APN 9 21593735 missense probably damaging 0.97
R0063:Timm29 UTSW 9 21593008 missense probably benign 0.22
R0295:Timm29 UTSW 9 21593076 splice site probably null
R3054:Timm29 UTSW 9 21593591 missense probably damaging 1.00
R4429:Timm29 UTSW 9 21593479 missense probably damaging 0.99
R5853:Timm29 UTSW 9 21593453 missense probably damaging 0.99
R7168:Timm29 UTSW 9 21593453 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACGTGAACCTGGGCTTTTG -3'
(R):5'- CGGACTGAACCAGTGAATCAG -3'

Sequencing Primer
(F):5'- GCTCGCTGGTTTACGAAGC -3'
(R):5'- TGAACCAGTGAATCAGCCTCG -3'
Posted On2015-02-05