Incidental Mutation 'R3056:Pccb'
ID265181
Institutional Source Beutler Lab
Gene Symbol Pccb
Ensembl Gene ENSMUSG00000032527
Gene Namepropionyl Coenzyme A carboxylase, beta polypeptide
Synonyms
MMRRC Submission 040565-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3056 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location100982032-101034898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101030197 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 79 (R79Q)
Ref Sequence ENSEMBL: ENSMUSP00000123421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035116] [ENSMUST00000142676] [ENSMUST00000149322] [ENSMUST00000189498]
Predicted Effect probably damaging
Transcript: ENSMUST00000035116
AA Change: R119Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035116
Gene: ENSMUSG00000032527
AA Change: R119Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Carboxyl_trans 59 539 6.2e-197 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142676
AA Change: R79Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123421
Gene: ENSMUSG00000032527
AA Change: R79Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Carboxyl_trans 52 256 3.2e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145091
Predicted Effect probably damaging
Transcript: ENSMUST00000149322
AA Change: R119Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118006
Gene: ENSMUSG00000032527
AA Change: R119Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Carboxyl_trans 59 187 2.3e-45 PFAM
Pfam:Carboxyl_trans 183 502 2.7e-127 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189498
SMART Domains Protein: ENSMUSP00000140354
Gene: ENSMUSG00000032527

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Carboxyl_trans 59 102 2.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the propionyl-CoA carboxylase (PCC) enzyme, which is involved in the catabolism of propionyl-CoA. PCC is a mitochondrial enzyme that probably acts as a dodecamer of six alpha subunits and six beta subunits. This gene encodes the beta subunit of PCC. Defects in this gene are a cause of propionic acidemia type II (PA-2). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,457,283 probably null Het
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Abca1 A T 4: 53,127,626 M131K probably benign Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Asb14 A G 14: 26,914,189 I510V possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Gpatch11 A G 17: 78,843,843 T228A probably damaging Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1087 C A 2: 86,690,552 C141F possibly damaging Het
Olfr1163 T A 2: 88,071,239 T48S probably benign Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn2r110 T A 17: 20,583,098 Y405F probably damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Other mutations in Pccb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Pccb APN 9 100985869 missense probably damaging 1.00
IGL02101:Pccb APN 9 100987841 missense possibly damaging 0.53
IGL02149:Pccb APN 9 100985190 missense probably damaging 1.00
IGL02938:Pccb APN 9 100984396 missense probably benign 0.35
PIT4402001:Pccb UTSW 9 100995592 missense probably benign 0.01
R0446:Pccb UTSW 9 100982797 missense probably damaging 1.00
R2128:Pccb UTSW 9 100985831 missense probably damaging 1.00
R2292:Pccb UTSW 9 100994632 missense probably benign
R4574:Pccb UTSW 9 100985199 missense probably damaging 1.00
R4600:Pccb UTSW 9 101034779 missense probably benign
R5087:Pccb UTSW 9 100985243 intron probably benign
R5219:Pccb UTSW 9 100985209 nonsense probably null
R5586:Pccb UTSW 9 100985803 missense possibly damaging 0.87
R5724:Pccb UTSW 9 100987847 missense probably benign 0.02
R6813:Pccb UTSW 9 101023215 missense probably damaging 1.00
R6982:Pccb UTSW 9 101023296 intron probably null
R7253:Pccb UTSW 9 101031913 missense probably benign 0.01
R7535:Pccb UTSW 9 100994562 splice site probably null
R7795:Pccb UTSW 9 100999263 missense probably damaging 1.00
R7822:Pccb UTSW 9 101027084 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCATGTAACACACTGCTTCTAG -3'
(R):5'- AACCCCACATTCTACATTGCTACTG -3'

Sequencing Primer
(F):5'- GTGTGTCTGAAAACAGTGACCCTTC -3'
(R):5'- CACGAAAAGGAAGTATTTGTTG -3'
Posted On2015-02-05