Incidental Mutation 'R3056:Cxcr6'
ID265182
Institutional Source Beutler Lab
Gene Symbol Cxcr6
Ensembl Gene ENSMUSG00000048521
Gene Namechemokine (C-X-C motif) receptor 6
SynonymsSTRL33, BONZO
MMRRC Submission 040565-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3056 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location123806475-123811760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123810464 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 177 (I177F)
Ref Sequence ENSEMBL: ENSMUSP00000060776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049810] [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000216072]
Predicted Effect probably damaging
Transcript: ENSMUST00000049810
AA Change: I177F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000060776
Gene: ENSMUSG00000048521
AA Change: I177F

DomainStartEndE-ValueType
Pfam:7tm_1 57 297 5.2e-43 PFAM
low complexity region 324 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084715
SMART Domains Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 19 167 4.7e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167595
SMART Domains Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 20 167 7.8e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000216072
AA Change: I184F

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.2774 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: A small percentage of mice that are heterozygous or homozygous for a knock-out allele develop medulloblastomas in the cerebellum after 12 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,457,283 probably null Het
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Abca1 A T 4: 53,127,626 M131K probably benign Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Asb14 A G 14: 26,914,189 I510V possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Gpatch11 A G 17: 78,843,843 T228A probably damaging Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1087 C A 2: 86,690,552 C141F possibly damaging Het
Olfr1163 T A 2: 88,071,239 T48S probably benign Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Pccb C T 9: 101,030,197 R79Q probably damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn2r110 T A 17: 20,583,098 Y405F probably damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Other mutations in Cxcr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Cxcr6 APN 9 123810705 missense probably damaging 0.96
IGL03192:Cxcr6 APN 9 123810046 missense possibly damaging 0.52
IGL03342:Cxcr6 APN 9 123810407 nonsense probably null
PIT4362001:Cxcr6 UTSW 9 123810461 missense probably benign 0.00
R0399:Cxcr6 UTSW 9 123810951 missense possibly damaging 0.70
R0487:Cxcr6 UTSW 9 123810398 missense probably benign 0.02
R1496:Cxcr6 UTSW 9 123810347 missense probably benign 0.12
R1662:Cxcr6 UTSW 9 123810548 missense possibly damaging 0.71
R1733:Cxcr6 UTSW 9 123810116 missense probably damaging 1.00
R1869:Cxcr6 UTSW 9 123809957 missense probably benign 0.37
R3055:Cxcr6 UTSW 9 123810464 missense probably damaging 1.00
R3771:Cxcr6 UTSW 9 123810485 missense probably benign 0.02
R3828:Cxcr6 UTSW 9 123810869 missense probably benign
R4810:Cxcr6 UTSW 9 123810162 missense probably damaging 1.00
R5685:Cxcr6 UTSW 9 123810746 missense probably benign 0.01
R5748:Cxcr6 UTSW 9 123810341 missense probably damaging 1.00
R6210:Cxcr6 UTSW 9 123810008 missense possibly damaging 0.95
R6612:Cxcr6 UTSW 9 123810720 missense probably damaging 1.00
R6773:Cxcr6 UTSW 9 123810290 missense possibly damaging 0.83
R7414:Cxcr6 UTSW 9 123810222 nonsense probably null
R7427:Cxcr6 UTSW 9 123810240 missense probably benign 0.41
R7428:Cxcr6 UTSW 9 123810240 missense probably benign 0.41
R7863:Cxcr6 UTSW 9 123810849 missense probably damaging 0.98
R7946:Cxcr6 UTSW 9 123810849 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACCTATGAGTGGGTCTTTGGC -3'
(R):5'- GGAAGTTTCGAGCATGAAGC -3'

Sequencing Primer
(F):5'- TGTGCAAAACTCTTCGAGGC -3'
(R):5'- CAAGGTCTTGATAATGCCTGAGTAGC -3'
Posted On2015-02-05