Incidental Mutation 'R3056:Asb14'
ID265187
Institutional Source Beutler Lab
Gene Symbol Asb14
Ensembl Gene ENSMUSG00000021898
Gene Nameankyrin repeat and SOCS box-containing 14
Synonyms
MMRRC Submission 040565-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R3056 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location26894557-26915258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26914189 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 510 (I510V)
Ref Sequence ENSEMBL: ENSMUSP00000087810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570] [ENSMUST00000090337] [ENSMUST00000165929]
Predicted Effect probably benign
Transcript: ENSMUST00000036570
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090337
AA Change: I510V

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000087810
Gene: ENSMUSG00000021898
AA Change: I510V

DomainStartEndE-ValueType
ANK 109 138 9.62e2 SMART
ANK 144 173 2.34e-1 SMART
ANK 177 206 1.7e-3 SMART
ANK 210 239 1.7e-3 SMART
ANK 243 272 2.66e-5 SMART
ANK 276 305 4.75e-2 SMART
ANK 309 337 4.31e2 SMART
ANK 341 370 5.24e-4 SMART
ANK 383 412 3.6e-2 SMART
ANK 413 442 5.45e-2 SMART
ANK 450 477 1.9e3 SMART
SOCS_box 559 601 1.8e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165305
SMART Domains Protein: ENSMUSP00000131669
Gene: ENSMUSG00000021898

DomainStartEndE-ValueType
ANK 26 55 1.7e-3 SMART
ANK 59 88 7.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165929
AA Change: I510V

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129753
Gene: ENSMUSG00000021898
AA Change: I510V

DomainStartEndE-ValueType
ANK 109 138 9.62e2 SMART
ANK 144 173 2.34e-1 SMART
ANK 177 206 1.7e-3 SMART
ANK 210 239 1.7e-3 SMART
ANK 243 272 2.66e-5 SMART
ANK 276 305 4.75e-2 SMART
ANK 309 337 4.31e2 SMART
ANK 341 370 5.24e-4 SMART
ANK 383 412 3.6e-2 SMART
ANK 413 442 5.45e-2 SMART
ANK 450 477 1.9e3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,457,283 probably null Het
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Abca1 A T 4: 53,127,626 M131K probably benign Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Gpatch11 A G 17: 78,843,843 T228A probably damaging Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1087 C A 2: 86,690,552 C141F possibly damaging Het
Olfr1163 T A 2: 88,071,239 T48S probably benign Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Pccb C T 9: 101,030,197 R79Q probably damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn2r110 T A 17: 20,583,098 Y405F probably damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Other mutations in Asb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Asb14 APN 14 26912041 missense probably benign 0.01
IGL01412:Asb14 APN 14 26915065 missense probably damaging 1.00
IGL02805:Asb14 APN 14 26901187 missense possibly damaging 0.89
IGL03100:Asb14 APN 14 26903372 missense probably benign 0.03
R1208:Asb14 UTSW 14 26900418 splice site probably benign
R1707:Asb14 UTSW 14 26901122 missense probably benign 0.14
R1828:Asb14 UTSW 14 26911840 missense possibly damaging 0.67
R3926:Asb14 UTSW 14 26897738 missense possibly damaging 0.92
R4991:Asb14 UTSW 14 26915058 missense probably damaging 1.00
R4996:Asb14 UTSW 14 26912116 missense possibly damaging 0.94
R5306:Asb14 UTSW 14 26911909 missense probably damaging 1.00
R5524:Asb14 UTSW 14 26900451 missense possibly damaging 0.94
R7032:Asb14 UTSW 14 26903455 missense probably benign 0.06
R7202:Asb14 UTSW 14 26900437 missense probably benign 0.13
R7259:Asb14 UTSW 14 26903455 missense probably benign 0.06
R7468:Asb14 UTSW 14 26900848 missense probably benign 0.10
R7733:Asb14 UTSW 14 26912352 missense probably benign 0.00
R7765:Asb14 UTSW 14 26897761 missense probably benign 0.03
R8162:Asb14 UTSW 14 26911988 missense probably benign 0.01
Z1088:Asb14 UTSW 14 26903348 missense probably benign 0.02
Z1177:Asb14 UTSW 14 26912299 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAACCATCTGCCACTCACTG -3'
(R):5'- CATTTGCGGGGAAGTGATAATAAGC -3'

Sequencing Primer
(F):5'- ACTCACTGCCTCGTGTGAG -3'
(R):5'- AGGTCAACCTTTTAATCAGAAGTG -3'
Posted On2015-02-05