Incidental Mutation 'R3056:Gpatch11'
ID265193
Institutional Source Beutler Lab
Gene Symbol Gpatch11
Ensembl Gene ENSMUSG00000050668
Gene NameG patch domain containing 11
Synonyms
MMRRC Submission 040565-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R3056 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78835516-78848299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78843843 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 228 (T228A)
Ref Sequence ENSEMBL: ENSMUSP00000126814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170759]
Predicted Effect probably damaging
Transcript: ENSMUST00000170759
AA Change: T228A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126814
Gene: ENSMUSG00000050668
AA Change: T228A

DomainStartEndE-ValueType
G_patch 71 117 5.8e-14 SMART
DUF4187 195 263 1.51e-25 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,457,283 probably null Het
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Abca1 A T 4: 53,127,626 M131K probably benign Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Asb14 A G 14: 26,914,189 I510V possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1087 C A 2: 86,690,552 C141F possibly damaging Het
Olfr1163 T A 2: 88,071,239 T48S probably benign Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Pccb C T 9: 101,030,197 R79Q probably damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn2r110 T A 17: 20,583,098 Y405F probably damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Other mutations in Gpatch11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Gpatch11 APN 17 78842164 missense probably benign
IGL02125:Gpatch11 APN 17 78840109 missense probably benign 0.21
IGL02183:Gpatch11 APN 17 78842231 critical splice donor site probably null
IGL02223:Gpatch11 APN 17 78845179 missense probably benign 0.23
IGL02224:Gpatch11 APN 17 78841093 splice site probably benign
IGL03116:Gpatch11 APN 17 78843853 nonsense probably null
FR4340:Gpatch11 UTSW 17 78842174 small insertion probably benign
FR4342:Gpatch11 UTSW 17 78842178 small insertion probably benign
FR4449:Gpatch11 UTSW 17 78842168 small insertion probably benign
FR4449:Gpatch11 UTSW 17 78842176 small insertion probably benign
FR4449:Gpatch11 UTSW 17 78842181 small insertion probably benign
FR4548:Gpatch11 UTSW 17 78842175 small insertion probably benign
FR4737:Gpatch11 UTSW 17 78842171 small insertion probably benign
FR4737:Gpatch11 UTSW 17 78842180 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842170 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842171 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842172 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842173 nonsense probably null
FR4976:Gpatch11 UTSW 17 78842180 small insertion probably benign
R1670:Gpatch11 UTSW 17 78839100 missense possibly damaging 0.85
R1986:Gpatch11 UTSW 17 78843837 missense probably benign 0.04
R2071:Gpatch11 UTSW 17 78841085 critical splice donor site probably null
R4348:Gpatch11 UTSW 17 78841017 missense probably damaging 1.00
R4352:Gpatch11 UTSW 17 78841017 missense probably damaging 1.00
R5426:Gpatch11 UTSW 17 78841234 missense possibly damaging 0.47
R5546:Gpatch11 UTSW 17 78842119 nonsense probably null
R6681:Gpatch11 UTSW 17 78840099 missense probably damaging 1.00
R7221:Gpatch11 UTSW 17 78842117 missense possibly damaging 0.69
R7409:Gpatch11 UTSW 17 78839166 missense probably damaging 1.00
R7662:Gpatch11 UTSW 17 78839055 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGCGGACAAGTGGTTAGTC -3'
(R):5'- AGTCACTATTTCTTTGCAACGTCG -3'

Sequencing Primer
(F):5'- TTAGTCAGCTGAGACATGCC -3'
(R):5'- GGCCCCACACTGTTAACTGAATG -3'
Posted On2015-02-05