Incidental Mutation 'R3076:Dlgap3'
ID265203
Institutional Source Beutler Lab
Gene Symbol Dlgap3
Ensembl Gene ENSMUSG00000042388
Gene NameDLG associated protein 3
SynonymsPSD-95/SAP90-binding protein 3, SAP90/PSD 95 associated protein 3, Sapap3, DAP3, Prpl8
MMRRC Submission 040566-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R3076 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location127169204-127237022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127195706 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 365 (Y365C)
Ref Sequence ENSEMBL: ENSMUSP00000101700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046659] [ENSMUST00000106092] [ENSMUST00000106094]
Predicted Effect probably damaging
Transcript: ENSMUST00000046659
AA Change: Y365C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039724
Gene: ENSMUSG00000042388
AA Change: Y365C

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 6.49e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 6.49e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 619 977 1.3e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106092
AA Change: Y365C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101698
Gene: ENSMUSG00000042388
AA Change: Y365C

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 5.59e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 5.59e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 619 966 1.8e-127 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106094
AA Change: Y365C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101700
Gene: ENSMUSG00000042388
AA Change: Y365C

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 6.49e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 6.49e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 626 977 1.3e-149 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit skin lesions associated with excessive grooming, increased anxiety-related behaviors, altered synaptic transmission and abnormal sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A C 13: 63,240,115 D3A probably damaging Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Amigo2 C T 15: 97,245,434 R369Q probably damaging Het
Arfgef3 T C 10: 18,603,530 I1446V probably damaging Het
Ascc2 T A 11: 4,672,446 L504Q probably damaging Het
Atp1a3 A G 7: 24,980,073 V932A possibly damaging Het
Cabcoco1 T G 10: 68,525,645 Y8S possibly damaging Het
Cct8 A G 16: 87,488,877 V231A possibly damaging Het
Col18a1 T C 10: 77,088,928 K9R possibly damaging Het
Dock3 T C 9: 106,941,526 probably null Het
Gtf3c4 A T 2: 28,835,153 V189E possibly damaging Het
Khdc3 C A 9: 73,102,930 F89L probably damaging Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Magi1 T C 6: 93,757,687 Q393R possibly damaging Het
Med28 A G 5: 45,522,478 T68A possibly damaging Het
Meis1 A T 11: 19,011,254 N206K probably benign Het
Mnt G C 11: 74,843,110 probably benign Het
Mrgpre C T 7: 143,781,296 A157T probably benign Het
Mtpn C T 6: 35,521,944 V76I possibly damaging Het
Nbeal2 A T 9: 110,631,700 W1702R probably damaging Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Npr2 T A 4: 43,640,182 Y306N probably damaging Het
Nrsn1 T C 13: 25,253,559 T129A probably benign Het
Nrxn3 T G 12: 89,260,416 C274G probably damaging Het
Nyap2 T C 1: 81,241,971 probably null Het
Olfr108 T C 17: 37,445,484 probably benign Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Phldb2 T C 16: 45,825,010 T403A probably benign Het
Plaa T C 4: 94,569,805 I643V probably benign Het
Ptprb T C 10: 116,344,026 S1450P probably damaging Het
Sh2d2a T C 3: 87,852,170 I296T probably benign Het
Shtn1 T C 19: 58,995,086 E471G probably damaging Het
St7 T G 6: 17,846,238 Y163* probably null Het
Svil T C 18: 5,116,055 S1623P probably damaging Het
Ugcg T G 4: 59,213,922 V168G probably damaging Het
Vmn1r223 G A 13: 23,250,165 A310T probably benign Het
Zfp647 A T 15: 76,918,009 M1K probably null Het
Other mutations in Dlgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Dlgap3 APN 4 127233897 missense probably benign 0.01
IGL03122:Dlgap3 APN 4 127195225 missense possibly damaging 0.86
IGL03259:Dlgap3 APN 4 127200284 missense probably benign 0.05
Compulsive UTSW 4 127195709 nonsense probably null
R0363:Dlgap3 UTSW 4 127235521 missense probably damaging 1.00
R1222:Dlgap3 UTSW 4 127194613 start codon destroyed probably null 0.01
R1386:Dlgap3 UTSW 4 127194926 missense possibly damaging 0.81
R1603:Dlgap3 UTSW 4 127195228 missense probably damaging 1.00
R2073:Dlgap3 UTSW 4 127195366 missense probably damaging 0.99
R2119:Dlgap3 UTSW 4 127236189 missense probably benign
R2696:Dlgap3 UTSW 4 127194623 missense probably damaging 1.00
R3738:Dlgap3 UTSW 4 127195606 missense probably damaging 0.99
R4344:Dlgap3 UTSW 4 127214348 missense possibly damaging 0.84
R4676:Dlgap3 UTSW 4 127233761 missense probably damaging 0.99
R4720:Dlgap3 UTSW 4 127195715 critical splice donor site probably null
R4893:Dlgap3 UTSW 4 127194983 missense probably damaging 1.00
R5384:Dlgap3 UTSW 4 127236330 missense probably damaging 1.00
R5841:Dlgap3 UTSW 4 127195400 missense probably damaging 1.00
R5870:Dlgap3 UTSW 4 127195709 nonsense probably null
R6379:Dlgap3 UTSW 4 127234974 missense probably damaging 1.00
R7028:Dlgap3 UTSW 4 127195517 missense possibly damaging 0.74
R7454:Dlgap3 UTSW 4 127235059 missense probably null 0.01
R7479:Dlgap3 UTSW 4 127194625 missense possibly damaging 0.72
R8104:Dlgap3 UTSW 4 127236154 missense probably damaging 0.99
X0024:Dlgap3 UTSW 4 127236172 missense probably damaging 1.00
Z1177:Dlgap3 UTSW 4 127194984 missense probably damaging 0.99
Z1177:Dlgap3 UTSW 4 127235498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTACAGGGACTTGAGCTTC -3'
(R):5'- GATCCCTTCATTGTACAAATGGGG -3'

Sequencing Primer
(F):5'- AGCTTCAAGGGGCGTTC -3'
(R):5'- CCCTTCATTGTACAAATGGGGAAAGG -3'
Posted On2015-02-05