Incidental Mutation 'R3076:St7'
ID265206
Institutional Source Beutler Lab
Gene Symbol St7
Ensembl Gene ENSMUSG00000029534
Gene Namesuppression of tumorigenicity 7
SynonymsRAY1, SEN4, Fam4a2, TSG7, 9430001H04Rik, HELG
MMRRC Submission 040566-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R3076 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location17692933-17943025 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 17846238 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 163 (Y163*)
Ref Sequence ENSEMBL: ENSMUSP00000111080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000674] [ENSMUST00000052113] [ENSMUST00000053148] [ENSMUST00000077080] [ENSMUST00000081635] [ENSMUST00000115417] [ENSMUST00000115418] [ENSMUST00000115419] [ENSMUST00000115420] [ENSMUST00000125673] [ENSMUST00000144488] [ENSMUST00000150281]
Predicted Effect probably null
Transcript: ENSMUST00000000674
AA Change: Y117*
SMART Domains Protein: ENSMUSP00000000674
Gene: ENSMUSG00000029534
AA Change: Y117*

DomainStartEndE-ValueType
Pfam:ST7 2 507 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000052113
AA Change: Y163*
SMART Domains Protein: ENSMUSP00000062886
Gene: ENSMUSG00000029534
AA Change: Y163*

DomainStartEndE-ValueType
Pfam:ST7 16 554 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000053148
AA Change: Y120*
SMART Domains Protein: ENSMUSP00000057326
Gene: ENSMUSG00000029534
AA Change: Y120*

DomainStartEndE-ValueType
Pfam:ST7 3 534 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000077080
AA Change: Y117*
SMART Domains Protein: ENSMUSP00000076334
Gene: ENSMUSG00000029534
AA Change: Y117*

DomainStartEndE-ValueType
Pfam:ST7 2 531 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000081635
AA Change: Y163*
SMART Domains Protein: ENSMUSP00000080341
Gene: ENSMUSG00000029534
AA Change: Y163*

DomainStartEndE-ValueType
Pfam:ST7 17 576 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115417
AA Change: Y120*
SMART Domains Protein: ENSMUSP00000111077
Gene: ENSMUSG00000029534
AA Change: Y120*

DomainStartEndE-ValueType
Pfam:ST7 3 511 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115418
AA Change: Y163*
SMART Domains Protein: ENSMUSP00000111078
Gene: ENSMUSG00000029534
AA Change: Y163*

DomainStartEndE-ValueType
Pfam:ST7 16 480 5e-278 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115419
AA Change: Y163*
SMART Domains Protein: ENSMUSP00000111079
Gene: ENSMUSG00000029534
AA Change: Y163*

DomainStartEndE-ValueType
Pfam:ST7 16 572 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115420
AA Change: Y163*
SMART Domains Protein: ENSMUSP00000111080
Gene: ENSMUSG00000029534
AA Change: Y163*

DomainStartEndE-ValueType
Pfam:ST7 16 448 2.5e-278 PFAM
Pfam:ST7 445 523 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125673
SMART Domains Protein: ENSMUSP00000122970
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 52 1.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127181
AA Change: *170G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144021
AA Change: *170G
Predicted Effect probably benign
Transcript: ENSMUST00000144488
SMART Domains Protein: ENSMUSP00000115215
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 82 6.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150281
SMART Domains Protein: ENSMUSP00000116304
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 58 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154497
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene for this product maps to a region on chromosome 7 identified as an autism-susceptibility locus. Mutation screening of the entire coding region in autistic individuals failed to identify phenotype-specific variants, suggesting that coding mutations for this gene are unlikely to be involved in the etiology of autism. The function of this gene product has not been determined. Transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A C 13: 63,240,115 D3A probably damaging Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Amigo2 C T 15: 97,245,434 R369Q probably damaging Het
Arfgef3 T C 10: 18,603,530 I1446V probably damaging Het
Ascc2 T A 11: 4,672,446 L504Q probably damaging Het
Atp1a3 A G 7: 24,980,073 V932A possibly damaging Het
Cabcoco1 T G 10: 68,525,645 Y8S possibly damaging Het
Cct8 A G 16: 87,488,877 V231A possibly damaging Het
Col18a1 T C 10: 77,088,928 K9R possibly damaging Het
Dlgap3 A G 4: 127,195,706 Y365C probably damaging Het
Dock3 T C 9: 106,941,526 probably null Het
Gtf3c4 A T 2: 28,835,153 V189E possibly damaging Het
Khdc3 C A 9: 73,102,930 F89L probably damaging Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Magi1 T C 6: 93,757,687 Q393R possibly damaging Het
Med28 A G 5: 45,522,478 T68A possibly damaging Het
Meis1 A T 11: 19,011,254 N206K probably benign Het
Mnt G C 11: 74,843,110 probably benign Het
Mrgpre C T 7: 143,781,296 A157T probably benign Het
Mtpn C T 6: 35,521,944 V76I possibly damaging Het
Nbeal2 A T 9: 110,631,700 W1702R probably damaging Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Npr2 T A 4: 43,640,182 Y306N probably damaging Het
Nrsn1 T C 13: 25,253,559 T129A probably benign Het
Nrxn3 T G 12: 89,260,416 C274G probably damaging Het
Nyap2 T C 1: 81,241,971 probably null Het
Olfr108 T C 17: 37,445,484 probably benign Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Phldb2 T C 16: 45,825,010 T403A probably benign Het
Plaa T C 4: 94,569,805 I643V probably benign Het
Ptprb T C 10: 116,344,026 S1450P probably damaging Het
Sh2d2a T C 3: 87,852,170 I296T probably benign Het
Shtn1 T C 19: 58,995,086 E471G probably damaging Het
Svil T C 18: 5,116,055 S1623P probably damaging Het
Ugcg T G 4: 59,213,922 V168G probably damaging Het
Vmn1r223 G A 13: 23,250,165 A310T probably benign Het
Zfp647 A T 15: 76,918,009 M1K probably null Het
Other mutations in St7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:St7 APN 6 17855006 missense probably damaging 1.00
IGL01312:St7 APN 6 17922014 missense probably damaging 1.00
IGL01562:St7 APN 6 17922035 missense probably damaging 0.99
IGL01935:St7 APN 6 17930823 missense probably damaging 0.99
IGL02127:St7 APN 6 17844969 intron probably benign
IGL02954:St7 APN 6 17848031 missense probably damaging 1.00
IGL02980:St7 UTSW 6 17749546 intron probably benign
R0457:St7 UTSW 6 17819282 missense probably damaging 1.00
R0666:St7 UTSW 6 17934239 missense probably damaging 1.00
R0680:St7 UTSW 6 17942733 missense probably damaging 0.99
R1575:St7 UTSW 6 17886111 missense probably damaging 1.00
R2039:St7 UTSW 6 17886112 missense probably damaging 1.00
R2144:St7 UTSW 6 17886007 missense possibly damaging 0.58
R2194:St7 UTSW 6 17942719 missense probably damaging 1.00
R2869:St7 UTSW 6 17819277 missense probably damaging 1.00
R2869:St7 UTSW 6 17819277 missense probably damaging 1.00
R2873:St7 UTSW 6 17819277 missense probably damaging 1.00
R2874:St7 UTSW 6 17819277 missense probably damaging 1.00
R2970:St7 UTSW 6 17844909 missense probably damaging 1.00
R3921:St7 UTSW 6 17846245 missense probably benign 0.31
R4326:St7 UTSW 6 17819288 missense probably damaging 1.00
R4327:St7 UTSW 6 17819288 missense probably damaging 1.00
R4410:St7 UTSW 6 17854933 nonsense probably null
R4732:St7 UTSW 6 17906516 splice site probably null
R4733:St7 UTSW 6 17906516 splice site probably null
R4868:St7 UTSW 6 17819266 missense probably damaging 1.00
R4988:St7 UTSW 6 17934226 missense probably damaging 0.99
R5132:St7 UTSW 6 17854957 missense probably damaging 0.97
R5182:St7 UTSW 6 17846237 missense probably damaging 0.99
R5195:St7 UTSW 6 17743637 intron probably benign
R5358:St7 UTSW 6 17819318 missense probably damaging 1.00
R5502:St7 UTSW 6 17834674 missense possibly damaging 0.94
R5882:St7 UTSW 6 17846249 missense probably damaging 1.00
R5976:St7 UTSW 6 17694222 missense possibly damaging 0.93
R6049:St7 UTSW 6 17694348 missense possibly damaging 0.92
R6139:St7 UTSW 6 17694354 missense probably damaging 1.00
R6177:St7 UTSW 6 17819334 critical splice donor site probably null
R6181:St7 UTSW 6 17694364 critical splice donor site probably null
R6401:St7 UTSW 6 17855318 unclassified probably null
R6546:St7 UTSW 6 17852314 missense probably damaging 1.00
R6711:St7 UTSW 6 17848070 missense possibly damaging 0.82
R6898:St7 UTSW 6 17854946 missense probably damaging 1.00
R7536:St7 UTSW 6 17886020 missense probably damaging 0.99
R7583:St7 UTSW 6 17942754 missense possibly damaging 0.54
R7626:St7 UTSW 6 17934217 missense probably damaging 1.00
R7718:St7 UTSW 6 17854999 missense probably damaging 0.99
Z1176:St7 UTSW 6 17848045 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCATGTGTCTGTGTGCCAA -3'
(R):5'- TAGATGTCCTCCCTCGGTCG -3'

Sequencing Primer
(F):5'- ATCCAACAGGAGTCCTTTGG -3'
(R):5'- ATTACAGATGTGCGCCAGC -3'
Posted On2015-02-05