Incidental Mutation 'K7894:Olfr652'
ID26521
Institutional Source Beutler Lab
Gene Symbol Olfr652
Ensembl Gene ENSMUSG00000073927
Gene Nameolfactory receptor 652
SynonymsMOR31-8, GA_x6K02T2PBJ9-7191524-7192471
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #K7894 () of strain 468
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location104560901-104568634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104564532 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 104 (T104A)
Ref Sequence ENSEMBL: ENSMUSP00000152027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098175] [ENSMUST00000215410] [ENSMUST00000216131] [ENSMUST00000219111]
Predicted Effect probably benign
Transcript: ENSMUST00000098175
AA Change: T104A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095777
Gene: ENSMUSG00000073927
AA Change: T104A

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:7tm_4 36 315 2.6e-105 PFAM
Pfam:7TM_GPCR_Srsx 40 312 6.9e-9 PFAM
Pfam:7tm_1 46 297 4.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215410
AA Change: T104A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216131
AA Change: T104A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000219111
AA Change: T104A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1908 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.4%
Validation Efficiency 88% (22/25)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C CAA 3: 122,147,868 probably null Het
Acsl4 C T X: 142,328,060 V632I probably benign Het
Adcy8 T C 15: 64,822,234 H398R probably benign Het
Catsperg1 C T 7: 29,197,154 probably benign Het
Ccpg1 T C 9: 73,001,877 probably null Het
Clk4 G T 11: 51,275,766 probably benign Het
Ehbp1 C T 11: 22,089,683 probably benign Het
Eri2 T C 7: 119,785,271 D669G probably benign Het
Nlrp9c A G 7: 26,384,898 S419P possibly damaging Het
Pde8a C A 7: 81,306,765 P304H probably damaging Het
Prmt3 A G 7: 49,826,711 Y356C probably damaging Het
Rsph10b A G 5: 143,944,520 D151G probably damaging Het
Spryd3 A G 15: 102,118,141 V365A probably benign Het
Vmn1r58 T C 7: 5,410,703 N176S probably benign Het
Other mutations in Olfr652
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Olfr652 APN 7 104564829 missense probably damaging 1.00
IGL01620:Olfr652 APN 7 104565013 missense probably damaging 0.97
IGL01712:Olfr652 APN 7 104565019 missense probably benign
IGL02211:Olfr652 APN 7 104565126 nonsense probably null
IGL03328:Olfr652 APN 7 104564470 missense probably damaging 1.00
R0138:Olfr652 UTSW 7 104565003 missense probably benign
R0632:Olfr652 UTSW 7 104564337 missense probably benign 0.00
R1457:Olfr652 UTSW 7 104565071 missense probably damaging 1.00
R1494:Olfr652 UTSW 7 104564831 nonsense probably null
R1879:Olfr652 UTSW 7 104564911 missense possibly damaging 0.93
R2188:Olfr652 UTSW 7 104564676 missense probably benign 0.00
R2323:Olfr652 UTSW 7 104564619 missense probably benign 0.01
R3862:Olfr652 UTSW 7 104564938 missense probably benign 0.01
R3908:Olfr652 UTSW 7 104564641 missense probably benign 0.01
R4942:Olfr652 UTSW 7 104565005 missense probably benign 0.00
R5443:Olfr652 UTSW 7 104564376 missense probably benign 0.14
R5572:Olfr652 UTSW 7 104564994 missense probably benign 0.08
R6045:Olfr652 UTSW 7 104564767 missense probably benign 0.42
R6973:Olfr652 UTSW 7 104564976 missense probably benign 0.42
R7147:Olfr652 UTSW 7 104564066 start gained probably benign
R7349:Olfr652 UTSW 7 104564650 missense probably benign
X0024:Olfr652 UTSW 7 104564250 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTATGGAGCGTAGCCTGCATGAGC -3'
(R):5'- ATGTCAGCACAAGCCAGACGAG -3'

Sequencing Primer
(F):5'- GCATGAGCCCATGTTCTTTTTC -3'
(R):5'- GCAATGCCTATGTGCTCACAG -3'
Posted On2013-04-16