Incidental Mutation 'R3077:Unc45a'
ID265252
Institutional Source Beutler Lab
Gene Symbol Unc45a
Ensembl Gene ENSMUSG00000030533
Gene Nameunc-45 myosin chaperone A
Synonyms
MMRRC Submission 040567-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3077 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location80325292-80341005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 80338932 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 112 (V112G)
Ref Sequence ENSEMBL: ENSMUSP00000119665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032747] [ENSMUST00000032748] [ENSMUST00000107368] [ENSMUST00000127997] [ENSMUST00000133728] [ENSMUST00000154428] [ENSMUST00000205531] [ENSMUST00000205744] [ENSMUST00000205768] [ENSMUST00000206480] [ENSMUST00000206122] [ENSMUST00000206074] [ENSMUST00000206089]
Predicted Effect probably benign
Transcript: ENSMUST00000032747
SMART Domains Protein: ENSMUSP00000032747
Gene: ENSMUSG00000030532

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
HDc 28 136 1.01e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000032748
AA Change: V112G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032748
Gene: ENSMUSG00000030533
AA Change: V112G

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 287 505 1.2e-43 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107368
AA Change: V112G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102991
Gene: ENSMUSG00000030533
AA Change: V112G

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 314 505 2.4e-38 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127997
SMART Domains Protein: ENSMUSP00000114428
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
Pfam:TPR_11 4 74 8.4e-19 PFAM
Pfam:TPR_1 6 36 2.3e-6 PFAM
Pfam:TPR_2 6 37 2.6e-6 PFAM
Pfam:TPR_16 10 82 1e-7 PFAM
Pfam:TPR_1 43 69 4.4e-4 PFAM
Pfam:TPR_2 43 74 3.1e-4 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000133728
AA Change: V97G
SMART Domains Protein: ENSMUSP00000123399
Gene: ENSMUSG00000030533
AA Change: V97G

DomainStartEndE-ValueType
TPR 6 39 9.53e-2 SMART
TPR 43 76 5.48e-2 SMART
TPR 77 110 7.45e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145351
Predicted Effect probably damaging
Transcript: ENSMUST00000154428
AA Change: V112G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119665
Gene: ENSMUSG00000030533
AA Change: V112G

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 4e-9 BLAST
Blast:ARM 226 266 6e-8 BLAST
Pfam:UNC45-central 287 505 3.5e-44 PFAM
low complexity region 597 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205448
Predicted Effect probably benign
Transcript: ENSMUST00000205531
Predicted Effect probably benign
Transcript: ENSMUST00000205744
Predicted Effect probably benign
Transcript: ENSMUST00000205768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206032
Predicted Effect unknown
Transcript: ENSMUST00000206363
AA Change: V46G
Predicted Effect probably benign
Transcript: ENSMUST00000206559
Predicted Effect probably benign
Transcript: ENSMUST00000206480
Predicted Effect probably benign
Transcript: ENSMUST00000206122
Predicted Effect probably benign
Transcript: ENSMUST00000206074
Predicted Effect probably benign
Transcript: ENSMUST00000206089
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC45A plays a role in cell proliferation and myoblast fusion, binds progesterone receptor (PGR; MIM 607311) and HSP90 (HSPCA; MIM 140571), and acts as a regulator of the progesterone receptor chaperoning pathway (Price et al., 2002 [PubMed 12356907]; Chadli et al., 2006 [PubMed 16478993]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Arfgef3 T C 10: 18,603,530 I1446V probably damaging Het
Cabcoco1 T G 10: 68,525,645 Y8S possibly damaging Het
Champ1 T C 8: 13,878,832 V330A probably benign Het
Dnajc8 A G 4: 132,544,663 D70G probably damaging Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Mnt G C 11: 74,843,110 probably benign Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Olfr576 G T 7: 102,966,016 K305N probably benign Het
Pcdhb11 C T 18: 37,422,244 T209I probably benign Het
Pdzd8 A G 19: 59,305,156 probably null Het
Phactr4 A G 4: 132,397,996 M1T probably null Het
Pwwp2a A G 11: 43,705,385 N184S probably damaging Het
Shprh T C 10: 11,170,413 V958A probably damaging Het
Smc3 A G 19: 53,627,891 E449G probably benign Het
Snap91 T A 9: 86,838,854 Y96F possibly damaging Het
Trim34b A G 7: 104,331,301 R199G possibly damaging Het
Vwa8 A T 14: 79,098,342 N1413Y probably benign Het
Zcchc9 A T 13: 91,805,982 N51K probably benign Het
Zfp628 A G 7: 4,921,200 E807G possibly damaging Het
Zfp647 A T 15: 76,918,009 M1K probably null Het
Other mutations in Unc45a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02252:Unc45a APN 7 80332969 intron probably benign
IGL02266:Unc45a APN 7 80328486 missense probably damaging 0.96
IGL02383:Unc45a APN 7 80339662 nonsense probably null
IGL02959:Unc45a APN 7 80332973 intron probably benign
IGL03168:Unc45a APN 7 80333133 missense probably damaging 1.00
PIT4131001:Unc45a UTSW 7 80326361 missense possibly damaging 0.74
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0276:Unc45a UTSW 7 80326297 intron probably benign
R0373:Unc45a UTSW 7 80326344 missense probably damaging 0.97
R1827:Unc45a UTSW 7 80331740 missense possibly damaging 0.77
R2120:Unc45a UTSW 7 80340098 missense probably benign 0.29
R2440:Unc45a UTSW 7 80329057 missense probably damaging 1.00
R2442:Unc45a UTSW 7 80339669 missense probably damaging 1.00
R2508:Unc45a UTSW 7 80338875 missense probably benign
R3108:Unc45a UTSW 7 80331546 intron probably benign
R3109:Unc45a UTSW 7 80331546 intron probably benign
R3620:Unc45a UTSW 7 80334051 missense possibly damaging 0.84
R4471:Unc45a UTSW 7 80332980 missense possibly damaging 0.94
R4644:Unc45a UTSW 7 80328509 missense probably damaging 1.00
R4651:Unc45a UTSW 7 80333029 missense possibly damaging 0.93
R4838:Unc45a UTSW 7 80333035 missense probably damaging 1.00
R5234:Unc45a UTSW 7 80328799 missense probably benign 0.17
R5452:Unc45a UTSW 7 80329039 missense probably damaging 1.00
R5574:Unc45a UTSW 7 80334856 missense probably damaging 0.98
R5750:Unc45a UTSW 7 80334823 missense probably benign 0.17
R6169:Unc45a UTSW 7 80328763 missense possibly damaging 0.92
R6417:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6420:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6486:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6533:Unc45a UTSW 7 80334069 missense probably damaging 1.00
R6734:Unc45a UTSW 7 80336998 missense probably damaging 1.00
R6993:Unc45a UTSW 7 80325655 missense probably damaging 1.00
R7085:Unc45a UTSW 7 80326334 missense possibly damaging 0.87
R7180:Unc45a UTSW 7 80329821 splice site probably null
R7561:Unc45a UTSW 7 80331586 missense possibly damaging 0.63
R8079:Unc45a UTSW 7 80331562 missense probably damaging 1.00
R8395:Unc45a UTSW 7 80326332 missense probably benign 0.08
R8547:Unc45a UTSW 7 80326092 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GTTACCAGTAGCTCCTCTCTGG -3'
(R):5'- TCACCTTTTCTGAGGCTGAAGC -3'

Sequencing Primer
(F):5'- CTGGAGTACTGTGTCTACATCC -3'
(R):5'- TTTCTGAGGCTGAAGCACCGAG -3'
Posted On2015-02-05