Incidental Mutation 'R3077:Nhsl2'
ID265271
Institutional Source Beutler Lab
Gene Symbol Nhsl2
Ensembl Gene ENSMUSG00000079481
Gene NameNHS-like 2
SynonymsGm10456, 1110062M06Rik
MMRRC Submission 040567-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.043) question?
Stock #R3077 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location101849385-102092055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102077595 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 62 (R62W)
Ref Sequence ENSEMBL: ENSMUSP00000143176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101339] [ENSMUST00000124279] [ENSMUST00000144753]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101339
AA Change: R335W

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098893
Gene: ENSMUSG00000079481
AA Change: R335W

DomainStartEndE-ValueType
low complexity region 48 62 N/A INTRINSIC
low complexity region 68 84 N/A INTRINSIC
low complexity region 135 155 N/A INTRINSIC
Pfam:NHS 494 613 3.8e-11 PFAM
Pfam:NHS 607 771 1.5e-25 PFAM
low complexity region 827 836 N/A INTRINSIC
low complexity region 935 952 N/A INTRINSIC
low complexity region 989 1002 N/A INTRINSIC
low complexity region 1145 1160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124279
SMART Domains Protein: ENSMUSP00000116112
Gene: ENSMUSG00000079481

DomainStartEndE-ValueType
low complexity region 48 62 N/A INTRINSIC
low complexity region 68 94 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129185
Predicted Effect probably damaging
Transcript: ENSMUST00000144753
AA Change: R62W

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155477
Meta Mutation Damage Score 0.1125 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Arfgef3 T C 10: 18,603,530 I1446V probably damaging Het
Cabcoco1 T G 10: 68,525,645 Y8S possibly damaging Het
Champ1 T C 8: 13,878,832 V330A probably benign Het
Dnajc8 A G 4: 132,544,663 D70G probably damaging Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Mnt G C 11: 74,843,110 probably benign Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Olfr576 G T 7: 102,966,016 K305N probably benign Het
Pcdhb11 C T 18: 37,422,244 T209I probably benign Het
Pdzd8 A G 19: 59,305,156 probably null Het
Phactr4 A G 4: 132,397,996 M1T probably null Het
Pwwp2a A G 11: 43,705,385 N184S probably damaging Het
Shprh T C 10: 11,170,413 V958A probably damaging Het
Smc3 A G 19: 53,627,891 E449G probably benign Het
Snap91 T A 9: 86,838,854 Y96F possibly damaging Het
Trim34b A G 7: 104,331,301 R199G possibly damaging Het
Unc45a A C 7: 80,338,932 V112G probably damaging Het
Vwa8 A T 14: 79,098,342 N1413Y probably benign Het
Zcchc9 A T 13: 91,805,982 N51K probably benign Het
Zfp628 A G 7: 4,921,200 E807G possibly damaging Het
Zfp647 A T 15: 76,918,009 M1K probably null Het
Other mutations in Nhsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Nhsl2 APN X 102078252 missense probably damaging 1.00
IGL02901:Nhsl2 APN X 102079243 missense probably benign 0.25
IGL03038:Nhsl2 APN X 102078885 missense probably damaging 1.00
IGL03120:Nhsl2 APN X 102071333 missense probably benign 0.14
IGL03144:Nhsl2 APN X 102079509 missense possibly damaging 0.94
R3076:Nhsl2 UTSW X 102077595 missense probably damaging 0.98
R3078:Nhsl2 UTSW X 102077595 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAGCTGTTGGCAAGTGGTG -3'
(R):5'- AAAGCATCTCCCTTCCAGGAAG -3'

Sequencing Primer
(F):5'- GTTCTTGTCACAAAGCAGCTG -3'
(R):5'- CAGGAAGTGGAGAATGTTGACTCTG -3'
Posted On2015-02-05