Incidental Mutation 'R3078:Vmn2r2'
ID265279
Institutional Source Beutler Lab
Gene Symbol Vmn2r2
Ensembl Gene ENSMUSG00000043897
Gene Namevomeronasal 2, receptor 2
Synonyms
MMRRC Submission 040568-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R3078 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64116432-64140543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64134632 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 221 (I221V)
Ref Sequence ENSEMBL: ENSMUSP00000135110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077958] [ENSMUST00000177151]
Predicted Effect probably benign
Transcript: ENSMUST00000077958
AA Change: I137V

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077109
Gene: ENSMUSG00000043897
AA Change: I137V

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 4.5e-80 PFAM
Pfam:NCD3G 458 511 8.3e-18 PFAM
Pfam:7tm_3 542 779 1.3e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177151
AA Change: I221V

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135110
Gene: ENSMUSG00000043897
AA Change: I221V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 83 500 1.6e-84 PFAM
Pfam:NCD3G 542 595 2.6e-17 PFAM
Pfam:7tm_3 628 862 1.9e-47 PFAM
Meta Mutation Damage Score 0.1502 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 93% (42/45)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G C 5: 24,546,666 T528S probably benign Het
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Actr3b A G 5: 25,822,442 Y37C probably damaging Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Alg10b T C 15: 90,227,936 S328P probably benign Het
C5ar2 G A 7: 16,237,424 R193C probably damaging Het
Cct8 A G 16: 87,488,877 V231A possibly damaging Het
Clca4a C T 3: 144,968,253 M240I probably damaging Het
Cmya5 A T 13: 93,048,927 I3520N probably damaging Het
Dock6 G T 9: 21,845,754 probably benign Het
Dynlrb1 T A 2: 155,249,945 I99N probably damaging Het
Ebf4 G A 2: 130,306,499 D77N probably damaging Het
Fam196a A G 7: 134,918,021 I260T probably benign Het
Fbxw10 C T 11: 62,867,513 probably benign Het
Gm10801 T C 2: 98,663,852 I113T probably damaging Het
Gm14085 T C 2: 122,514,414 L167P possibly damaging Het
Gm5499 T C 17: 87,078,886 noncoding transcript Het
Gm9913 A G 2: 125,506,539 probably benign Het
Herc2 A G 7: 56,137,243 N1612S probably benign Het
Ifnar2 T C 16: 91,386,001 S53P possibly damaging Het
Inpp5j T A 11: 3,503,124 probably null Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Med28 A G 5: 45,522,478 T68A possibly damaging Het
Meis1 A T 11: 19,011,254 N206K probably benign Het
Mfsd14a T C 3: 116,647,917 probably benign Het
Mnt G C 11: 74,843,110 probably benign Het
Mto1 A G 9: 78,458,028 Y413C probably damaging Het
Myo7b T C 18: 31,967,184 D1599G probably benign Het
Myoz1 T C 14: 20,653,617 probably benign Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Npr2 T A 4: 43,640,182 Y306N probably damaging Het
Nrxn3 T G 12: 89,260,416 C274G probably damaging Het
Olfr204 A T 16: 59,314,726 M227K probably benign Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Phldb2 T C 16: 45,825,010 T403A probably benign Het
Plaa T C 4: 94,569,805 I643V probably benign Het
Stau1 T C 2: 166,955,016 I154V possibly damaging Het
Ugcg T G 4: 59,213,922 V168G probably damaging Het
Wdr93 T C 7: 79,752,493 I180T possibly damaging Het
Whamm G C 7: 81,571,784 G155R probably damaging Het
Wnt5a T A 14: 28,513,183 Y41* probably null Het
Other mutations in Vmn2r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Vmn2r2 APN 3 64133898 splice site probably benign
IGL00980:Vmn2r2 APN 3 64117180 missense probably benign 0.11
IGL01389:Vmn2r2 APN 3 64117009 missense probably damaging 0.97
IGL01804:Vmn2r2 APN 3 64134256 missense possibly damaging 0.91
IGL02750:Vmn2r2 APN 3 64117402 missense probably damaging 1.00
IGL02829:Vmn2r2 APN 3 64118751 splice site probably benign
IGL03036:Vmn2r2 APN 3 64116900 missense probably benign 0.01
IGL03174:Vmn2r2 APN 3 64117123 nonsense probably null
PIT4151001:Vmn2r2 UTSW 3 64116913 missense possibly damaging 0.67
R0029:Vmn2r2 UTSW 3 64116944 missense probably benign 0.00
R0310:Vmn2r2 UTSW 3 64134618 missense probably damaging 1.00
R0357:Vmn2r2 UTSW 3 64133899 splice site probably null
R0637:Vmn2r2 UTSW 3 64126578 missense probably benign 0.00
R1626:Vmn2r2 UTSW 3 64134500 missense possibly damaging 0.61
R1662:Vmn2r2 UTSW 3 64117130 missense probably benign 0.00
R1710:Vmn2r2 UTSW 3 64117399 missense probably benign 0.19
R1797:Vmn2r2 UTSW 3 64134707 missense probably benign 0.00
R1862:Vmn2r2 UTSW 3 64134521 missense possibly damaging 0.79
R1971:Vmn2r2 UTSW 3 64126700 missense probably damaging 1.00
R2051:Vmn2r2 UTSW 3 64117345 missense possibly damaging 0.77
R2099:Vmn2r2 UTSW 3 64117053 missense probably damaging 1.00
R2275:Vmn2r2 UTSW 3 64116509 missense probably benign 0.00
R3418:Vmn2r2 UTSW 3 64116899 missense probably benign 0.00
R3419:Vmn2r2 UTSW 3 64116899 missense probably benign 0.00
R3959:Vmn2r2 UTSW 3 64140526 missense probably benign
R4230:Vmn2r2 UTSW 3 64134491 missense probably benign 0.00
R4258:Vmn2r2 UTSW 3 64134697 missense probably damaging 1.00
R4810:Vmn2r2 UTSW 3 64137462 missense probably damaging 1.00
R4822:Vmn2r2 UTSW 3 64134539 missense probably damaging 0.99
R4919:Vmn2r2 UTSW 3 64117157 missense possibly damaging 0.56
R4925:Vmn2r2 UTSW 3 64137471 start codon destroyed probably null 0.03
R4954:Vmn2r2 UTSW 3 64140484 missense probably benign 0.00
R5071:Vmn2r2 UTSW 3 64116900 missense probably benign 0.01
R5315:Vmn2r2 UTSW 3 64116956 missense probably benign 0.37
R5450:Vmn2r2 UTSW 3 64126590 missense probably benign
R5577:Vmn2r2 UTSW 3 64116995 missense probably benign 0.00
R5595:Vmn2r2 UTSW 3 64126615 missense possibly damaging 0.74
R5727:Vmn2r2 UTSW 3 64117187 missense probably benign 0.41
R5810:Vmn2r2 UTSW 3 64117394 missense probably damaging 1.00
R5919:Vmn2r2 UTSW 3 64137302 missense probably benign 0.39
R6052:Vmn2r2 UTSW 3 64117361 missense possibly damaging 0.56
R6084:Vmn2r2 UTSW 3 64117046 missense probably benign 0.01
R6299:Vmn2r2 UTSW 3 64116653 nonsense probably null
R6762:Vmn2r2 UTSW 3 64134449 missense probably damaging 1.00
R6858:Vmn2r2 UTSW 3 64137494 missense probably damaging 1.00
R6889:Vmn2r2 UTSW 3 64117267 missense probably damaging 0.99
R6990:Vmn2r2 UTSW 3 64117187 missense probably benign 0.02
R7195:Vmn2r2 UTSW 3 64116479 missense probably benign 0.01
R7269:Vmn2r2 UTSW 3 64126577 missense probably benign 0.32
R7717:Vmn2r2 UTSW 3 64134598 missense possibly damaging 0.95
R7798:Vmn2r2 UTSW 3 64134097 missense possibly damaging 0.60
X0024:Vmn2r2 UTSW 3 64137286 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTTCCAGCACAAATGGGC -3'
(R):5'- AAGTTGGTTCCTGTTTCCTAGTAAC -3'

Sequencing Primer
(F):5'- ATGGGCCGAGGTCAATGTC -3'
(R):5'- GGGCTATACTTCTTCCTGTG -3'
Posted On2015-02-05