Incidental Mutation 'K7894:Spryd3'
ID26528
Institutional Source Beutler Lab
Gene Symbol Spryd3
Ensembl Gene ENSMUSG00000036966
Gene NameSPRY domain containing 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #K7894 () of strain 468
Quality Score225
Status Validated (trace)
Chromosome15
Chromosomal Location102116528-102136234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102118141 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 365 (V365A)
Ref Sequence ENSEMBL: ENSMUSP00000121493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000154032] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000230474]
Predicted Effect probably benign
Transcript: ENSMUST00000046144
SMART Domains Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1136 1236 1.69e-16 SMART
PTB 1269 1407 6.66e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139279
Predicted Effect probably benign
Transcript: ENSMUST00000154032
AA Change: V365A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000121493
Gene: ENSMUSG00000036966
AA Change: V365A

DomainStartEndE-ValueType
low complexity region 28 38 N/A INTRINSIC
SPRY 76 201 1.66e-11 SMART
SPRY 256 441 3.28e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169627
SMART Domains Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1129 1229 1.69e-16 SMART
PTB 1262 1400 6.66e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229800
Predicted Effect probably benign
Transcript: ENSMUST00000230474
Meta Mutation Damage Score 0.1162 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.4%
Validation Efficiency 88% (22/25)
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C CAA 3: 122,147,868 probably null Het
Acsl4 C T X: 142,328,060 V632I probably benign Het
Adcy8 T C 15: 64,822,234 H398R probably benign Het
Catsperg1 C T 7: 29,197,154 probably benign Het
Ccpg1 T C 9: 73,001,877 probably null Het
Clk4 G T 11: 51,275,766 probably benign Het
Ehbp1 C T 11: 22,089,683 probably benign Het
Eri2 T C 7: 119,785,271 D669G probably benign Het
Nlrp9c A G 7: 26,384,898 S419P possibly damaging Het
Olfr652 A G 7: 104,564,532 T104A probably benign Het
Pde8a C A 7: 81,306,765 P304H probably damaging Het
Prmt3 A G 7: 49,826,711 Y356C probably damaging Het
Rsph10b A G 5: 143,944,520 D151G probably damaging Het
Vmn1r58 T C 7: 5,410,703 N176S probably benign Het
Other mutations in Spryd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Spryd3 APN 15 102130276 critical splice donor site probably null
IGL02138:Spryd3 APN 15 102118919 unclassified probably benign
IGL02652:Spryd3 APN 15 102118990 splice site probably null
IGL02716:Spryd3 APN 15 102133461 missense possibly damaging 0.91
IGL02949:Spryd3 APN 15 102118109 missense probably benign 0.03
B6819:Spryd3 UTSW 15 102118141 missense probably benign 0.01
BB001:Spryd3 UTSW 15 102118327 missense probably benign 0.18
BB011:Spryd3 UTSW 15 102118327 missense probably benign 0.18
R0111:Spryd3 UTSW 15 102128537 critical splice donor site probably null
R0479:Spryd3 UTSW 15 102130400 nonsense probably null
R0654:Spryd3 UTSW 15 102128534 splice site probably null
R1014:Spryd3 UTSW 15 102133531 missense probably damaging 0.98
R1448:Spryd3 UTSW 15 102118392 missense possibly damaging 0.93
R1510:Spryd3 UTSW 15 102118961 missense probably damaging 0.99
R1863:Spryd3 UTSW 15 102117659 missense probably benign 0.17
R2069:Spryd3 UTSW 15 102118181 missense probably benign 0.01
R2212:Spryd3 UTSW 15 102130276 critical splice donor site probably null
R4581:Spryd3 UTSW 15 102130364 missense probably damaging 0.98
R4892:Spryd3 UTSW 15 102118102 missense probably benign 0.02
R5068:Spryd3 UTSW 15 102128611 missense probably benign 0.02
R5586:Spryd3 UTSW 15 102131937 missense probably benign
R5771:Spryd3 UTSW 15 102116907 unclassified probably benign
R5945:Spryd3 UTSW 15 102118195 missense probably benign 0.22
R7080:Spryd3 UTSW 15 102118192 missense probably benign 0.04
R7816:Spryd3 UTSW 15 102117706 missense probably damaging 0.99
R7924:Spryd3 UTSW 15 102118327 missense probably benign 0.18
R8524:Spryd3 UTSW 15 102118148 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGTGCTGAGGCTGGAAAATAGACC -3'
(R):5'- TTTGGGCCACGCTGCTACAAAG -3'

Sequencing Primer
(F):5'- GCTGGAAAATAGACCAGGACTCC -3'
(R):5'- GTGGAATCATGTTCCCCCG -3'
Posted On2013-04-16