Mutagenetix > Incidental Mutations

Incidental Mutation 'K7894:Spryd3'

26528

Institutional Source

Beutler Lab

Gene Symbol

Spryd3

Ensembl Gene

ENSMUSG00000036966

Gene Name

SPRY domain containing 3

Synonyms

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

K7894 () of strain 468

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

102116528-102136234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102118141 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 365 (V365A)

Ref Sequence

ENSEMBL: ENSMUSP00000121493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000154032] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000230474]

Predicted Effect

probably benign
Transcript: ENSMUST00000046144

SMART Domains

Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003

Domain	Start	End	E-Value	Type
C1	32	79	2.78e-9	SMART
SCOP:d1d5ra2	128	295	8e-24	SMART
PTEN_C2	297	424	6.63e-40	SMART
low complexity region	494	513	N/A	INTRINSIC
SH2	1136	1236	1.69e-16	SMART
PTB	1269	1407	6.66e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128884

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139279

Predicted Effect

probably benign
Transcript: ENSMUST00000154032
AA Change: V365A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000121493
Gene: ENSMUSG00000036966
AA Change: V365A

Domain	Start	End	E-Value	Type
low complexity region	28	38	N/A	INTRINSIC
SPRY	76	201	1.66e-11	SMART
SPRY	256	441	3.28e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169627

SMART Domains

Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003

Domain	Start	End	E-Value	Type
C1	32	79	2.78e-9	SMART
SCOP:d1d5ra2	128	295	8e-24	SMART
PTEN_C2	297	424	6.63e-40	SMART
low complexity region	494	513	N/A	INTRINSIC
SH2	1129	1229	1.69e-16	SMART
PTB	1262	1400	6.66e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000228958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229035

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229097

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229800

Predicted Effect

probably benign
Transcript: ENSMUST00000230474

Meta Mutation Damage Score

0.1162

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 95.4%

Validation Efficiency

88% (22/25)

Allele List at MGI

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	C	CAA	3: 122,147,868		probably null	Het
Acsl4	C	T	X: 142,328,060	V632I	probably benign	Het
Adcy8	T	C	15: 64,822,234	H398R	probably benign	Het
Catsperg1	C	T	7: 29,197,154		probably benign	Het
Ccpg1	T	C	9: 73,001,877		probably null	Het
Clk4	G	T	11: 51,275,766		probably benign	Het
Ehbp1	C	T	11: 22,089,683		probably benign	Het
Eri2	T	C	7: 119,785,271	D669G	probably benign	Het
Nlrp9c	A	G	7: 26,384,898	S419P	possibly damaging	Het
Olfr652	A	G	7: 104,564,532	T104A	probably benign	Het
Pde8a	C	A	7: 81,306,765	P304H	probably damaging	Het
Prmt3	A	G	7: 49,826,711	Y356C	probably damaging	Het
Rsph10b	A	G	5: 143,944,520	D151G	probably damaging	Het
Vmn1r58	T	C	7: 5,410,703	N176S	probably benign	Het

Other mutations in Spryd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01638:Spryd3	APN	15	102130276	critical splice donor site	probably null
IGL02138:Spryd3	APN	15	102118919	unclassified	probably benign
IGL02652:Spryd3	APN	15	102118990	splice site	probably null
IGL02716:Spryd3	APN	15	102133461	missense	possibly damaging	0.91
IGL02949:Spryd3	APN	15	102118109	missense	probably benign	0.03
B6819:Spryd3	UTSW	15	102118141	missense	probably benign	0.01
BB001:Spryd3	UTSW	15	102118327	missense	probably benign	0.18
BB011:Spryd3	UTSW	15	102118327	missense	probably benign	0.18
R0111:Spryd3	UTSW	15	102128537	critical splice donor site	probably null
R0479:Spryd3	UTSW	15	102130400	nonsense	probably null
R0654:Spryd3	UTSW	15	102128534	splice site	probably null
R1014:Spryd3	UTSW	15	102133531	missense	probably damaging	0.98
R1448:Spryd3	UTSW	15	102118392	missense	possibly damaging	0.93
R1510:Spryd3	UTSW	15	102118961	missense	probably damaging	0.99
R1863:Spryd3	UTSW	15	102117659	missense	probably benign	0.17
R2069:Spryd3	UTSW	15	102118181	missense	probably benign	0.01
R2212:Spryd3	UTSW	15	102130276	critical splice donor site	probably null
R4581:Spryd3	UTSW	15	102130364	missense	probably damaging	0.98
R4892:Spryd3	UTSW	15	102118102	missense	probably benign	0.02
R5068:Spryd3	UTSW	15	102128611	missense	probably benign	0.02
R5586:Spryd3	UTSW	15	102131937	missense	probably benign
R5771:Spryd3	UTSW	15	102116907	unclassified	probably benign
R5945:Spryd3	UTSW	15	102118195	missense	probably benign	0.22
R7080:Spryd3	UTSW	15	102118192	missense	probably benign	0.04
R7816:Spryd3	UTSW	15	102117706	missense	probably damaging	0.99
R7924:Spryd3	UTSW	15	102118327	missense	probably benign	0.18
R8524:Spryd3	UTSW	15	102118148	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTGTGCTGAGGCTGGAAAATAGACC -3'
(R):5'- TTTGGGCCACGCTGCTACAAAG -3'

Sequencing Primer
(F):5'- GCTGGAAAATAGACCAGGACTCC -3'
(R):5'- GTGGAATCATGTTCCCCCG -3'

Posted On

2013-04-16