Incidental Mutation 'R3078:Mfsd14a'
ID265280
Institutional Source Beutler Lab
Gene Symbol Mfsd14a
Ensembl Gene ENSMUSG00000089911
Gene Namemajor facilitator superfamily domain containing 14A
SynonymsHiat1
MMRRC Submission 040568-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.449) question?
Stock #R3078 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116631164-116662677 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 116647917 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029570]
Predicted Effect probably benign
Transcript: ENSMUST00000029570
SMART Domains Protein: ENSMUSP00000029570
Gene: ENSMUSG00000089911

DomainStartEndE-ValueType
Pfam:MFS_1 40 388 3.4e-33 PFAM
Pfam:MFS_2 182 407 3.6e-10 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138418
Predicted Effect probably benign
Transcript: ENSMUST00000140672
SMART Domains Protein: ENSMUSP00000114952
Gene: ENSMUSG00000105103

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 2 129 2.4e-39 PFAM
Pfam:MFS_1 104 235 1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150402
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 93% (42/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with oligozoospermia, globozoospermia, and defects in spermiogenesis and acrosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G C 5: 24,546,666 T528S probably benign Het
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Actr3b A G 5: 25,822,442 Y37C probably damaging Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Alg10b T C 15: 90,227,936 S328P probably benign Het
C5ar2 G A 7: 16,237,424 R193C probably damaging Het
Cct8 A G 16: 87,488,877 V231A possibly damaging Het
Clca4a C T 3: 144,968,253 M240I probably damaging Het
Cmya5 A T 13: 93,048,927 I3520N probably damaging Het
Dock6 G T 9: 21,845,754 probably benign Het
Dynlrb1 T A 2: 155,249,945 I99N probably damaging Het
Ebf4 G A 2: 130,306,499 D77N probably damaging Het
Fam196a A G 7: 134,918,021 I260T probably benign Het
Fbxw10 C T 11: 62,867,513 probably benign Het
Gm10801 T C 2: 98,663,852 I113T probably damaging Het
Gm14085 T C 2: 122,514,414 L167P possibly damaging Het
Gm5499 T C 17: 87,078,886 noncoding transcript Het
Gm9913 A G 2: 125,506,539 probably benign Het
Herc2 A G 7: 56,137,243 N1612S probably benign Het
Ifnar2 T C 16: 91,386,001 S53P possibly damaging Het
Inpp5j T A 11: 3,503,124 probably null Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Med28 A G 5: 45,522,478 T68A possibly damaging Het
Meis1 A T 11: 19,011,254 N206K probably benign Het
Mnt G C 11: 74,843,110 probably benign Het
Mto1 A G 9: 78,458,028 Y413C probably damaging Het
Myo7b T C 18: 31,967,184 D1599G probably benign Het
Myoz1 T C 14: 20,653,617 probably benign Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Npr2 T A 4: 43,640,182 Y306N probably damaging Het
Nrxn3 T G 12: 89,260,416 C274G probably damaging Het
Olfr204 A T 16: 59,314,726 M227K probably benign Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Phldb2 T C 16: 45,825,010 T403A probably benign Het
Plaa T C 4: 94,569,805 I643V probably benign Het
Stau1 T C 2: 166,955,016 I154V possibly damaging Het
Ugcg T G 4: 59,213,922 V168G probably damaging Het
Vmn2r2 T C 3: 64,134,632 I221V probably benign Het
Wdr93 T C 7: 79,752,493 I180T possibly damaging Het
Whamm G C 7: 81,571,784 G155R probably damaging Het
Wnt5a T A 14: 28,513,183 Y41* probably null Het
Other mutations in Mfsd14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03189:Mfsd14a APN 3 116641855 missense probably benign 0.16
IGL03197:Mfsd14a APN 3 116636363 missense probably benign 0.01
R1166:Mfsd14a UTSW 3 116633894 unclassified probably benign
R1796:Mfsd14a UTSW 3 116634947 missense probably damaging 1.00
R1842:Mfsd14a UTSW 3 116632408 missense possibly damaging 0.93
R1871:Mfsd14a UTSW 3 116641320 missense probably benign 0.11
R2155:Mfsd14a UTSW 3 116647830 missense probably damaging 1.00
R2176:Mfsd14a UTSW 3 116632393 missense probably benign 0.00
R4451:Mfsd14a UTSW 3 116662478 start codon destroyed probably null 0.77
R4794:Mfsd14a UTSW 3 116645506 intron probably benign
R5197:Mfsd14a UTSW 3 116648501 intron probably benign
R5868:Mfsd14a UTSW 3 116633750 missense probably benign
R7098:Mfsd14a UTSW 3 116641712 missense probably benign 0.22
R7603:Mfsd14a UTSW 3 116633883 missense probably damaging 0.97
R7836:Mfsd14a UTSW 3 116648551 missense possibly damaging 0.95
R7919:Mfsd14a UTSW 3 116648551 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCAGGGTCTCAGAAAAGGAC -3'
(R):5'- ACAGATGATTTCCTTAGCCAACC -3'

Sequencing Primer
(F):5'- CATTGGGAGAGCACCAGC -3'
(R):5'- GATGATTTCCTTAGCCAACCTAAAG -3'
Posted On2015-02-05