Incidental Mutation 'R3078:Clca4a'
ID 265281
Institutional Source Beutler Lab
Gene Symbol Clca4a
Ensembl Gene ENSMUSG00000068547
Gene Name chloride channel accessory 4A
Synonyms Clca6, 9130020L07Rik
MMRRC Submission 040568-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock # R3078 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 144952480-144975045 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 144968253 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 240 (M240I)
Ref Sequence ENSEMBL: ENSMUSP00000029923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029923]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029923
AA Change: M240I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029923
Gene: ENSMUSG00000068547
AA Change: M240I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 286 300 N/A INTRINSIC
VWA 306 480 5.94e-16 SMART
Blast:VWA 513 552 7e-18 BLAST
Blast:FN3 757 838 8e-33 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198898
Meta Mutation Damage Score 0.7162 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 93% (42/45)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G C 5: 24,546,666 T528S probably benign Het
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Actr3b A G 5: 25,822,442 Y37C probably damaging Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Alg10b T C 15: 90,227,936 S328P probably benign Het
C5ar2 G A 7: 16,237,424 R193C probably damaging Het
Cct8 A G 16: 87,488,877 V231A possibly damaging Het
Cmya5 A T 13: 93,048,927 I3520N probably damaging Het
Dock6 G T 9: 21,845,754 probably benign Het
Dynlrb1 T A 2: 155,249,945 I99N probably damaging Het
Ebf4 G A 2: 130,306,499 D77N probably damaging Het
Fam196a A G 7: 134,918,021 I260T probably benign Het
Fbxw10 C T 11: 62,867,513 probably benign Het
Gm10801 T C 2: 98,663,852 I113T probably damaging Het
Gm14085 T C 2: 122,514,414 L167P possibly damaging Het
Gm5499 T C 17: 87,078,886 noncoding transcript Het
Gm9913 A G 2: 125,506,539 probably benign Het
Herc2 A G 7: 56,137,243 N1612S probably benign Het
Ifnar2 T C 16: 91,386,001 S53P possibly damaging Het
Inpp5j T A 11: 3,503,124 probably null Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Med28 A G 5: 45,522,478 T68A possibly damaging Het
Meis1 A T 11: 19,011,254 N206K probably benign Het
Mfsd14a T C 3: 116,647,917 probably benign Het
Mnt G C 11: 74,843,110 probably benign Het
Mto1 A G 9: 78,458,028 Y413C probably damaging Het
Myo7b T C 18: 31,967,184 D1599G probably benign Het
Myoz1 T C 14: 20,653,617 probably benign Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Npr2 T A 4: 43,640,182 Y306N probably damaging Het
Nrxn3 T G 12: 89,260,416 C274G probably damaging Het
Olfr204 A T 16: 59,314,726 M227K probably benign Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Phldb2 T C 16: 45,825,010 T403A probably benign Het
Plaa T C 4: 94,569,805 I643V probably benign Het
Stau1 T C 2: 166,955,016 I154V possibly damaging Het
Ugcg T G 4: 59,213,922 V168G probably damaging Het
Vmn2r2 T C 3: 64,134,632 I221V probably benign Het
Wdr93 T C 7: 79,752,493 I180T possibly damaging Het
Whamm G C 7: 81,571,784 G155R probably damaging Het
Wnt5a T A 14: 28,513,183 Y41* probably null Het
Other mutations in Clca4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Clca4a APN 3 144954939 missense probably damaging 0.99
IGL01139:Clca4a APN 3 144966269 missense probably damaging 0.99
IGL01371:Clca4a APN 3 144960672 missense probably damaging 1.00
IGL01609:Clca4a APN 3 144953780 missense probably damaging 1.00
IGL01998:Clca4a APN 3 144958126 missense probably damaging 0.98
IGL02172:Clca4a APN 3 144970394 nonsense probably null
IGL02217:Clca4a APN 3 144961996 missense possibly damaging 0.61
IGL02514:Clca4a APN 3 144955071 missense probably damaging 1.00
IGL02975:Clca4a APN 3 144963769 missense possibly damaging 0.90
IGL03025:Clca4a APN 3 144957318 missense probably benign 0.07
IGL03049:Clca4a APN 3 144970755 splice site probably benign
IGL03058:Clca4a APN 3 144961834 splice site probably benign
IGL03259:Clca4a APN 3 144958080 missense probably damaging 1.00
IGL03263:Clca4a APN 3 144966431 missense probably damaging 1.00
IGL03334:Clca4a APN 3 144953866 missense probably benign 0.28
PIT4142001:Clca4a UTSW 3 144968311 missense probably damaging 1.00
R0201:Clca4a UTSW 3 144960717 missense probably benign 0.00
R0316:Clca4a UTSW 3 144953764 missense probably damaging 1.00
R0524:Clca4a UTSW 3 144969393 missense probably damaging 1.00
R0680:Clca4a UTSW 3 144969367 missense probably damaging 1.00
R0688:Clca4a UTSW 3 144961974 missense probably damaging 1.00
R1137:Clca4a UTSW 3 144970685 missense probably damaging 1.00
R1568:Clca4a UTSW 3 144952929 missense probably benign 0.00
R1719:Clca4a UTSW 3 144963755 missense probably damaging 1.00
R2055:Clca4a UTSW 3 144970728 missense probably damaging 1.00
R3080:Clca4a UTSW 3 144963790 missense probably damaging 1.00
R3789:Clca4a UTSW 3 144974956 missense probably damaging 1.00
R3881:Clca4a UTSW 3 144957318 missense probably benign 0.07
R4133:Clca4a UTSW 3 144969352 missense probably benign 0.07
R4402:Clca4a UTSW 3 144952848 missense probably benign 0.08
R4455:Clca4a UTSW 3 144957259 missense probably damaging 1.00
R4577:Clca4a UTSW 3 144954969 missense probably damaging 0.97
R4683:Clca4a UTSW 3 144954940 missense probably damaging 1.00
R5135:Clca4a UTSW 3 144954946 missense probably damaging 1.00
R5267:Clca4a UTSW 3 144953812 missense probably damaging 1.00
R5345:Clca4a UTSW 3 144970461 missense probably damaging 1.00
R6311:Clca4a UTSW 3 144966413 missense probably damaging 0.99
R6492:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6493:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6494:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6861:Clca4a UTSW 3 144970655 missense probably benign
R7102:Clca4a UTSW 3 144961909 missense probably benign 0.01
R7133:Clca4a UTSW 3 144961890 nonsense probably null
R7171:Clca4a UTSW 3 144958173 missense probably benign
R7516:Clca4a UTSW 3 144966248 missense probably damaging 1.00
R7642:Clca4a UTSW 3 144953751 missense probably benign 0.11
R7731:Clca4a UTSW 3 144952785 missense probably benign 0.02
R7787:Clca4a UTSW 3 144953833 missense probably benign
R7820:Clca4a UTSW 3 144960671 missense probably damaging 1.00
R7895:Clca4a UTSW 3 144968405 missense probably benign 0.19
R7991:Clca4a UTSW 3 144952739 missense possibly damaging 0.75
R8240:Clca4a UTSW 3 144970727 missense probably damaging 1.00
R9308:Clca4a UTSW 3 144970422 missense probably damaging 1.00
R9373:Clca4a UTSW 3 144966372 missense possibly damaging 0.66
R9488:Clca4a UTSW 3 144953771 missense probably damaging 1.00
R9772:Clca4a UTSW 3 144970661 missense probably damaging 1.00
R9781:Clca4a UTSW 3 144961952 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAAATATGCATGCTCAAGTAAAGTCC -3'
(R):5'- ATATCTTGCCACAAAGCTCAGTG -3'

Sequencing Primer
(F):5'- GGGTATCAGTCAATGTTCAATGGAC -3'
(R):5'- TGGGAGCAGGGCCACTTTTC -3'
Posted On 2015-02-05