Incidental Mutation 'R3078:Actr3b'
ID265286
Institutional Source Beutler Lab
Gene Symbol Actr3b
Ensembl Gene ENSMUSG00000056367
Gene NameARP3 actin-related protein 3B
SynonymsARP11, Arp3b
MMRRC Submission 040568-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.682) question?
Stock #R3078 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location25759997-25850688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25822442 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 37 (Y37C)
Ref Sequence ENSEMBL: ENSMUSP00000121629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088244] [ENSMUST00000128727]
Predicted Effect probably damaging
Transcript: ENSMUST00000088244
AA Change: Y125C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085578
Gene: ENSMUSG00000056367
AA Change: Y125C

DomainStartEndE-ValueType
ACTIN 5 413 1.33e-178 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128727
AA Change: Y37C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121629
Gene: ENSMUSG00000056367
AA Change: Y37C

DomainStartEndE-ValueType
ACTIN 1 325 1.27e-111 SMART
Meta Mutation Damage Score 0.2989 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the actin-related proteins (ARP), which form multiprotein complexes and share 35-55% amino acid identity with conventional actin. The protein encoded by this gene may have a regulatory role in the actin cytoskeleton and induce cell-shape change and motility. Pseudogenes of this gene are located on chromosomes 2, 4, 10, 16, 22 and Y. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G C 5: 24,546,666 T528S probably benign Het
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Alg10b T C 15: 90,227,936 S328P probably benign Het
C5ar2 G A 7: 16,237,424 R193C probably damaging Het
Cct8 A G 16: 87,488,877 V231A possibly damaging Het
Clca4a C T 3: 144,968,253 M240I probably damaging Het
Cmya5 A T 13: 93,048,927 I3520N probably damaging Het
Dock6 G T 9: 21,845,754 probably benign Het
Dynlrb1 T A 2: 155,249,945 I99N probably damaging Het
Ebf4 G A 2: 130,306,499 D77N probably damaging Het
Fam196a A G 7: 134,918,021 I260T probably benign Het
Fbxw10 C T 11: 62,867,513 probably benign Het
Gm10801 T C 2: 98,663,852 I113T probably damaging Het
Gm14085 T C 2: 122,514,414 L167P possibly damaging Het
Gm5499 T C 17: 87,078,886 noncoding transcript Het
Gm9913 A G 2: 125,506,539 probably benign Het
Herc2 A G 7: 56,137,243 N1612S probably benign Het
Ifnar2 T C 16: 91,386,001 S53P possibly damaging Het
Inpp5j T A 11: 3,503,124 probably null Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Med28 A G 5: 45,522,478 T68A possibly damaging Het
Meis1 A T 11: 19,011,254 N206K probably benign Het
Mfsd14a T C 3: 116,647,917 probably benign Het
Mnt G C 11: 74,843,110 probably benign Het
Mto1 A G 9: 78,458,028 Y413C probably damaging Het
Myo7b T C 18: 31,967,184 D1599G probably benign Het
Myoz1 T C 14: 20,653,617 probably benign Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Npr2 T A 4: 43,640,182 Y306N probably damaging Het
Nrxn3 T G 12: 89,260,416 C274G probably damaging Het
Olfr204 A T 16: 59,314,726 M227K probably benign Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Phldb2 T C 16: 45,825,010 T403A probably benign Het
Plaa T C 4: 94,569,805 I643V probably benign Het
Stau1 T C 2: 166,955,016 I154V possibly damaging Het
Ugcg T G 4: 59,213,922 V168G probably damaging Het
Vmn2r2 T C 3: 64,134,632 I221V probably benign Het
Wdr93 T C 7: 79,752,493 I180T possibly damaging Het
Whamm G C 7: 81,571,784 G155R probably damaging Het
Wnt5a T A 14: 28,513,183 Y41* probably null Het
Other mutations in Actr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Actr3b APN 5 25849162 splice site probably null
IGL02582:Actr3b APN 5 25832413 missense probably benign 0.11
IGL02869:Actr3b APN 5 25832435 missense probably damaging 1.00
IGL02946:Actr3b APN 5 25848483 missense possibly damaging 0.50
R0443:Actr3b UTSW 5 25848411 missense probably damaging 0.99
R0446:Actr3b UTSW 5 25831732 missense probably damaging 0.98
R0727:Actr3b UTSW 5 25811939 missense possibly damaging 0.89
R1070:Actr3b UTSW 5 25848493 splice site probably benign
R1643:Actr3b UTSW 5 25812011 missense probably damaging 1.00
R1820:Actr3b UTSW 5 25849158 critical splice donor site probably null
R1837:Actr3b UTSW 5 25825159 missense probably benign 0.00
R1899:Actr3b UTSW 5 25829538 missense possibly damaging 0.71
R2041:Actr3b UTSW 5 25760130 critical splice donor site probably null
R2096:Actr3b UTSW 5 25831745 nonsense probably null
R2109:Actr3b UTSW 5 25831711 missense possibly damaging 0.89
R2256:Actr3b UTSW 5 25822405 missense possibly damaging 0.88
R5572:Actr3b UTSW 5 25809888 missense probably benign 0.00
R5655:Actr3b UTSW 5 25848368 missense probably damaging 1.00
R6190:Actr3b UTSW 5 25831690 missense probably benign
R6761:Actr3b UTSW 5 25825139 missense probably damaging 1.00
R7003:Actr3b UTSW 5 25798463 missense probably damaging 1.00
R7043:Actr3b UTSW 5 25849938 missense probably benign 0.40
R7649:Actr3b UTSW 5 25848366 missense probably benign 0.05
R7897:Actr3b UTSW 5 25831659 missense probably benign 0.37
R8691:Actr3b UTSW 5 25825204 missense possibly damaging 0.94
RF049:Actr3b UTSW 5 25848488 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- AGTCATGAGAGCAGAAGCCC -3'
(R):5'- CAGTGGTAGTTATGAGTGTCTAGCC -3'

Sequencing Primer
(F):5'- CTTTGAAGACCCACAGTAGGCG -3'
(R):5'- GATAACAACGTGGGGTTT -3'
Posted On2015-02-05