Incidental Mutation 'R3078:Med28'
ID265287
Institutional Source Beutler Lab
Gene Symbol Med28
Ensembl Gene ENSMUSG00000015804
Gene Namemediator complex subunit 28
SynonymsEg1, magicin, 1500003D12Rik
MMRRC Submission 040568-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3078 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location45520229-45529276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45522478 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 68 (T68A)
Ref Sequence ENSEMBL: ENSMUSP00000113027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118833] [ENSMUST00000119579] [ENSMUST00000156481]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000015948
Predicted Effect possibly damaging
Transcript: ENSMUST00000118833
AA Change: T68A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113027
Gene: ENSMUSG00000015804
AA Change: T68A

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119579
SMART Domains Protein: ENSMUSP00000112418
Gene: ENSMUSG00000015804

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:Med28 44 116 3.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139586
Predicted Effect probably benign
Transcript: ENSMUST00000156481
AA Change: T68A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115882
Gene: ENSMUSG00000015804
AA Change: T68A

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:Med28 72 136 4.5e-21 PFAM
Meta Mutation Damage Score 0.0803 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 93% (42/45)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G C 5: 24,546,666 T528S probably benign Het
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Actr3b A G 5: 25,822,442 Y37C probably damaging Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Alg10b T C 15: 90,227,936 S328P probably benign Het
C5ar2 G A 7: 16,237,424 R193C probably damaging Het
Cct8 A G 16: 87,488,877 V231A possibly damaging Het
Clca4a C T 3: 144,968,253 M240I probably damaging Het
Cmya5 A T 13: 93,048,927 I3520N probably damaging Het
Dock6 G T 9: 21,845,754 probably benign Het
Dynlrb1 T A 2: 155,249,945 I99N probably damaging Het
Ebf4 G A 2: 130,306,499 D77N probably damaging Het
Fam196a A G 7: 134,918,021 I260T probably benign Het
Fbxw10 C T 11: 62,867,513 probably benign Het
Gm10801 T C 2: 98,663,852 I113T probably damaging Het
Gm14085 T C 2: 122,514,414 L167P possibly damaging Het
Gm5499 T C 17: 87,078,886 noncoding transcript Het
Gm9913 A G 2: 125,506,539 probably benign Het
Herc2 A G 7: 56,137,243 N1612S probably benign Het
Ifnar2 T C 16: 91,386,001 S53P possibly damaging Het
Inpp5j T A 11: 3,503,124 probably null Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Meis1 A T 11: 19,011,254 N206K probably benign Het
Mfsd14a T C 3: 116,647,917 probably benign Het
Mnt G C 11: 74,843,110 probably benign Het
Mto1 A G 9: 78,458,028 Y413C probably damaging Het
Myo7b T C 18: 31,967,184 D1599G probably benign Het
Myoz1 T C 14: 20,653,617 probably benign Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Npr2 T A 4: 43,640,182 Y306N probably damaging Het
Nrxn3 T G 12: 89,260,416 C274G probably damaging Het
Olfr204 A T 16: 59,314,726 M227K probably benign Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Phldb2 T C 16: 45,825,010 T403A probably benign Het
Plaa T C 4: 94,569,805 I643V probably benign Het
Stau1 T C 2: 166,955,016 I154V possibly damaging Het
Ugcg T G 4: 59,213,922 V168G probably damaging Het
Vmn2r2 T C 3: 64,134,632 I221V probably benign Het
Wdr93 T C 7: 79,752,493 I180T possibly damaging Het
Whamm G C 7: 81,571,784 G155R probably damaging Het
Wnt5a T A 14: 28,513,183 Y41* probably null Het
Other mutations in Med28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Med28 APN 5 45523470 missense probably damaging 1.00
IGL01702:Med28 APN 5 45525291 missense probably benign 0.07
IGL03062:Med28 APN 5 45522469 missense probably damaging 1.00
R3076:Med28 UTSW 5 45522478 missense possibly damaging 0.79
R5400:Med28 UTSW 5 45525199 missense probably damaging 1.00
R7083:Med28 UTSW 5 45523536 critical splice donor site probably null
R7208:Med28 UTSW 5 45523452 missense probably damaging 1.00
R7998:Med28 UTSW 5 45525199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCAGATACCAGTGTCTCAG -3'
(R):5'- GAGCCAGCAATTTATGGGGAC -3'

Sequencing Primer
(F):5'- AGATACCAGTGTCTCAGGTGCC -3'
(R):5'- CAGCAATTTATGGGGACTCTGCAC -3'
Posted On2015-02-05