Incidental Mutation 'K7894:Acsl4'
ID26529
Institutional Source Beutler Lab
Gene Symbol Acsl4
Ensembl Gene ENSMUSG00000031278
Gene Nameacyl-CoA synthetase long-chain family member 4
SynonymsFacl4, ACS4, Lacs4, 9430020A05Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock #K7894 () of strain 468
Quality Score222
Status Validated (trace)
ChromosomeX
Chromosomal Location142317993-142390535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 142328060 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 632 (V632I)
Ref Sequence ENSEMBL: ENSMUSP00000108528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033634] [ENSMUST00000112903] [ENSMUST00000112904] [ENSMUST00000112907]
Predicted Effect probably benign
Transcript: ENSMUST00000033634
AA Change: V632I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033634
Gene: ENSMUSG00000031278
AA Change: V632I

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:AMP-binding 102 578 1.4e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112903
AA Change: V591I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108524
Gene: ENSMUSG00000031278
AA Change: V591I

DomainStartEndE-ValueType
Pfam:AMP-binding 61 537 7.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112904
AA Change: V591I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108525
Gene: ENSMUSG00000031278
AA Change: V591I

DomainStartEndE-ValueType
Pfam:AMP-binding 61 537 7.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112907
AA Change: V632I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108528
Gene: ENSMUSG00000031278
AA Change: V632I

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:AMP-binding 102 578 2e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140520
Meta Mutation Damage Score 0.0789 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.4%
Validation Efficiency 88% (22/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme preferentially utilizes arachidonate as substrate. The absence of this enzyme may contribute to the mental retardation or Alport syndrome. Alternative splicing of this gene generates multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Female heterozygotes for a targeted null mutation exhibit accumulation of prostaglandins in the uterus, reduced fertility with few and small litters, and very low transmission of the mutant allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C CAA 3: 122,147,868 probably null Het
Adcy8 T C 15: 64,822,234 H398R probably benign Het
Catsperg1 C T 7: 29,197,154 probably benign Het
Ccpg1 T C 9: 73,001,877 probably null Het
Clk4 G T 11: 51,275,766 probably benign Het
Ehbp1 C T 11: 22,089,683 probably benign Het
Eri2 T C 7: 119,785,271 D669G probably benign Het
Nlrp9c A G 7: 26,384,898 S419P possibly damaging Het
Olfr652 A G 7: 104,564,532 T104A probably benign Het
Pde8a C A 7: 81,306,765 P304H probably damaging Het
Prmt3 A G 7: 49,826,711 Y356C probably damaging Het
Rsph10b A G 5: 143,944,520 D151G probably damaging Het
Spryd3 A G 15: 102,118,141 V365A probably benign Het
Vmn1r58 T C 7: 5,410,703 N176S probably benign Het
Other mutations in Acsl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Acsl4 APN X 142339952 missense possibly damaging 0.81
IGL00949:Acsl4 APN X 142343329 missense probably damaging 0.96
IGL01669:Acsl4 APN X 142343188 missense probably damaging 1.00
R0194:Acsl4 UTSW X 142333718 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAATACTAGGCTCCTCTCTACTGC -3'
(R):5'- TCAAAAGCCTGTGAGATTGAGCCAC -3'

Sequencing Primer
(F):5'- CTGCTCGTAGGACATAAATACCTTG -3'
(R):5'- GTGAGATTGAGCCACTTTCTTTATT -3'
Posted On2013-04-16