Incidental Mutation 'R3078:Whamm'
ID 265293
Institutional Source Beutler Lab
Gene Symbol Whamm
Ensembl Gene ENSMUSG00000045795
Gene Name WAS protein homolog associated with actin, golgi membranes and microtubules
Synonyms Whdc1
MMRRC Submission 040568-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3078 (G1)
Quality Score 178
Status Validated
Chromosome 7
Chromosomal Location 81221014-81246584 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 81221532 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 155 (G155R)
Ref Sequence ENSEMBL: ENSMUSP00000146687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042318] [ENSMUST00000165460] [ENSMUST00000207123] [ENSMUST00000209044]
AlphaFold Q571B6
Predicted Effect probably benign
Transcript: ENSMUST00000042318
SMART Domains Protein: ENSMUSP00000047775
Gene: ENSMUSG00000038663

DomainStartEndE-ValueType
low complexity region 102 121 N/A INTRINSIC
coiled coil region 204 231 N/A INTRINSIC
FN3 315 400 7.34e-9 SMART
FN3 412 494 2e-1 SMART
Pfam:PRY 509 558 8.6e-9 PFAM
Pfam:SPRY 564 683 2.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165460
AA Change: G155R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128881
Gene: ENSMUSG00000045795
AA Change: G155R

DomainStartEndE-ValueType
Pfam:WHAMM-JMY_N 5 54 1.1e-30 PFAM
Pfam:JMY 67 435 1.3e-157 PFAM
coiled coil region 448 470 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 631 656 N/A INTRINSIC
WH2 698 716 5.69e2 SMART
WH2 728 745 6.26e-2 SMART
coiled coil region 758 785 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207123
AA Change: G155R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000209044
Meta Mutation Damage Score 0.1931 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in actin nucleation, Golgi membrane association and microtubule binding. The encoded protein is a nucleation-promoting factor that regulates the Actin-related protein 2/3 complex. The activated complex initiates growth of new actin filaments by binding to existing actin filaments. The encoded protein also functions in regulation of transport from the endoplasmic reticulum to the Golgi complex and in maintenance of the Golgi complex near the centrosome. Four pseudogenes of this gene are present on the same arm of chromosome 15 as this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,306,764 (GRCm39) I1981V probably benign Het
Actr3b A G 5: 26,027,440 (GRCm39) Y37C probably damaging Het
Adgrd1 A T 5: 129,206,169 (GRCm39) I248F probably benign Het
Alg10b T C 15: 90,112,139 (GRCm39) S328P probably benign Het
C5ar2 G A 7: 15,971,349 (GRCm39) R193C probably damaging Het
Cct8 A G 16: 87,285,765 (GRCm39) V231A possibly damaging Het
Clca4a C T 3: 144,674,014 (GRCm39) M240I probably damaging Het
Cmya5 A T 13: 93,185,435 (GRCm39) I3520N probably damaging Het
Dock6 G T 9: 21,757,050 (GRCm39) probably benign Het
Dynlrb1 T A 2: 155,091,865 (GRCm39) I99N probably damaging Het
Ebf4 G A 2: 130,148,419 (GRCm39) D77N probably damaging Het
Fbxw10 C T 11: 62,758,339 (GRCm39) probably benign Het
Gm10801 T C 2: 98,494,197 (GRCm39) I113T probably damaging Het
Gm5499 T C 17: 87,386,314 (GRCm39) noncoding transcript Het
Gm9913 A G 2: 125,348,459 (GRCm39) probably benign Het
Herc2 A G 7: 55,786,991 (GRCm39) N1612S probably benign Het
Ifnar2 T C 16: 91,182,889 (GRCm39) S53P possibly damaging Het
Inpp5j T A 11: 3,453,124 (GRCm39) probably null Het
Insyn2a A G 7: 134,519,750 (GRCm39) I260T probably benign Het
Iqca1l G C 5: 24,751,664 (GRCm39) T528S probably benign Het
Kif14 T G 1: 136,447,383 (GRCm39) I1396S possibly damaging Het
Med28 A G 5: 45,679,820 (GRCm39) T68A possibly damaging Het
Meis1 A T 11: 18,961,254 (GRCm39) N206K probably benign Het
Mfsd14a T C 3: 116,441,566 (GRCm39) probably benign Het
Mnt G C 11: 74,733,936 (GRCm39) probably benign Het
Mto1 A G 9: 78,365,310 (GRCm39) Y413C probably damaging Het
Myo7b T C 18: 32,100,237 (GRCm39) D1599G probably benign Het
Myoz1 T C 14: 20,703,685 (GRCm39) probably benign Het
Nhsl2 C T X: 101,121,201 (GRCm39) R62W probably damaging Het
Npr2 T A 4: 43,640,182 (GRCm39) Y306N probably damaging Het
Nrxn3 T G 12: 89,227,186 (GRCm39) C274G probably damaging Het
Or1e29 G A 11: 73,667,466 (GRCm39) P229L possibly damaging Het
Or5ac22 A T 16: 59,135,089 (GRCm39) M227K probably benign Het
Phldb2 T C 16: 45,645,373 (GRCm39) T403A probably benign Het
Plaa T C 4: 94,458,042 (GRCm39) I643V probably benign Het
Slc28a2b T C 2: 122,344,895 (GRCm39) L167P possibly damaging Het
Stau1 T C 2: 166,796,936 (GRCm39) I154V possibly damaging Het
Ugcg T G 4: 59,213,922 (GRCm39) V168G probably damaging Het
Vmn2r2 T C 3: 64,042,053 (GRCm39) I221V probably benign Het
Wdr93 T C 7: 79,402,241 (GRCm39) I180T possibly damaging Het
Wnt5a T A 14: 28,235,140 (GRCm39) Y41* probably null Het
Other mutations in Whamm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Whamm APN 7 81,228,014 (GRCm39) missense probably damaging 1.00
IGL01139:Whamm APN 7 81,245,662 (GRCm39) missense probably damaging 1.00
IGL01870:Whamm APN 7 81,245,722 (GRCm39) missense probably damaging 0.96
IGL03153:Whamm APN 7 81,239,280 (GRCm39) splice site probably benign
R0179:Whamm UTSW 7 81,243,763 (GRCm39) missense probably benign 0.00
R0364:Whamm UTSW 7 81,243,799 (GRCm39) missense probably benign 0.00
R0550:Whamm UTSW 7 81,235,972 (GRCm39) missense possibly damaging 0.55
R0682:Whamm UTSW 7 81,235,886 (GRCm39) missense probably damaging 1.00
R1388:Whamm UTSW 7 81,236,038 (GRCm39) missense probably damaging 1.00
R1940:Whamm UTSW 7 81,228,047 (GRCm39) missense probably null 0.94
R1991:Whamm UTSW 7 81,241,519 (GRCm39) nonsense probably null
R1992:Whamm UTSW 7 81,241,519 (GRCm39) nonsense probably null
R2103:Whamm UTSW 7 81,241,519 (GRCm39) nonsense probably null
R2104:Whamm UTSW 7 81,241,519 (GRCm39) nonsense probably null
R2162:Whamm UTSW 7 81,221,089 (GRCm39) missense probably damaging 1.00
R2291:Whamm UTSW 7 81,241,519 (GRCm39) nonsense probably null
R4735:Whamm UTSW 7 81,221,122 (GRCm39) missense probably benign 0.01
R6336:Whamm UTSW 7 81,241,512 (GRCm39) missense probably damaging 1.00
R6723:Whamm UTSW 7 81,245,868 (GRCm39) missense probably damaging 1.00
R6747:Whamm UTSW 7 81,228,050 (GRCm39) critical splice donor site probably null
R7029:Whamm UTSW 7 81,241,574 (GRCm39) missense probably benign 0.09
R7286:Whamm UTSW 7 81,235,995 (GRCm39) missense probably damaging 0.98
R7525:Whamm UTSW 7 81,243,598 (GRCm39) missense probably damaging 1.00
R7732:Whamm UTSW 7 81,221,172 (GRCm39) missense probably damaging 1.00
R8348:Whamm UTSW 7 81,224,295 (GRCm39) missense probably damaging 0.98
R8448:Whamm UTSW 7 81,224,295 (GRCm39) missense probably damaging 0.98
R8769:Whamm UTSW 7 81,234,933 (GRCm39) nonsense probably null
R8890:Whamm UTSW 7 81,243,640 (GRCm39) missense probably benign 0.39
R9226:Whamm UTSW 7 81,243,655 (GRCm39) missense probably damaging 1.00
R9431:Whamm UTSW 7 81,236,035 (GRCm39) missense probably damaging 1.00
R9436:Whamm UTSW 7 81,221,063 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATCAGCTGCGTTTCCTGGTG -3'
(R):5'- CCACCGTGTTTCAACTTCAAG -3'

Sequencing Primer
(F):5'- CAGTTCGCCGTCACCTG -3'
(R):5'- TCTCTCTCAACAGAGGCGCAG -3'
Posted On 2015-02-05