Incidental Mutation 'R3078:Whamm'
ID265293
Institutional Source Beutler Lab
Gene Symbol Whamm
Ensembl Gene ENSMUSG00000045795
Gene NameWAS protein homolog associated with actin, golgi membranes and microtubules
SynonymsWhdc1
MMRRC Submission 040568-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3078 (G1)
Quality Score178
Status Validated
Chromosome7
Chromosomal Location81571266-81596836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 81571784 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 155 (G155R)
Ref Sequence ENSEMBL: ENSMUSP00000146687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042318] [ENSMUST00000165460] [ENSMUST00000207123] [ENSMUST00000209044]
Predicted Effect probably benign
Transcript: ENSMUST00000042318
SMART Domains Protein: ENSMUSP00000047775
Gene: ENSMUSG00000038663

DomainStartEndE-ValueType
low complexity region 102 121 N/A INTRINSIC
coiled coil region 204 231 N/A INTRINSIC
FN3 315 400 7.34e-9 SMART
FN3 412 494 2e-1 SMART
Pfam:PRY 509 558 8.6e-9 PFAM
Pfam:SPRY 564 683 2.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165460
AA Change: G155R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128881
Gene: ENSMUSG00000045795
AA Change: G155R

DomainStartEndE-ValueType
Pfam:WHAMM-JMY_N 5 54 1.1e-30 PFAM
Pfam:JMY 67 435 1.3e-157 PFAM
coiled coil region 448 470 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 631 656 N/A INTRINSIC
WH2 698 716 5.69e2 SMART
WH2 728 745 6.26e-2 SMART
coiled coil region 758 785 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207123
AA Change: G155R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000209044
Meta Mutation Damage Score 0.1931 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in actin nucleation, Golgi membrane association and microtubule binding. The encoded protein is a nucleation-promoting factor that regulates the Actin-related protein 2/3 complex. The activated complex initiates growth of new actin filaments by binding to existing actin filaments. The encoded protein also functions in regulation of transport from the endoplasmic reticulum to the Golgi complex and in maintenance of the Golgi complex near the centrosome. Four pseudogenes of this gene are present on the same arm of chromosome 15 as this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G C 5: 24,546,666 T528S probably benign Het
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Actr3b A G 5: 25,822,442 Y37C probably damaging Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Alg10b T C 15: 90,227,936 S328P probably benign Het
C5ar2 G A 7: 16,237,424 R193C probably damaging Het
Cct8 A G 16: 87,488,877 V231A possibly damaging Het
Clca4a C T 3: 144,968,253 M240I probably damaging Het
Cmya5 A T 13: 93,048,927 I3520N probably damaging Het
Dock6 G T 9: 21,845,754 probably benign Het
Dynlrb1 T A 2: 155,249,945 I99N probably damaging Het
Ebf4 G A 2: 130,306,499 D77N probably damaging Het
Fam196a A G 7: 134,918,021 I260T probably benign Het
Fbxw10 C T 11: 62,867,513 probably benign Het
Gm10801 T C 2: 98,663,852 I113T probably damaging Het
Gm14085 T C 2: 122,514,414 L167P possibly damaging Het
Gm5499 T C 17: 87,078,886 noncoding transcript Het
Gm9913 A G 2: 125,506,539 probably benign Het
Herc2 A G 7: 56,137,243 N1612S probably benign Het
Ifnar2 T C 16: 91,386,001 S53P possibly damaging Het
Inpp5j T A 11: 3,503,124 probably null Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Med28 A G 5: 45,522,478 T68A possibly damaging Het
Meis1 A T 11: 19,011,254 N206K probably benign Het
Mfsd14a T C 3: 116,647,917 probably benign Het
Mnt G C 11: 74,843,110 probably benign Het
Mto1 A G 9: 78,458,028 Y413C probably damaging Het
Myo7b T C 18: 31,967,184 D1599G probably benign Het
Myoz1 T C 14: 20,653,617 probably benign Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Npr2 T A 4: 43,640,182 Y306N probably damaging Het
Nrxn3 T G 12: 89,260,416 C274G probably damaging Het
Olfr204 A T 16: 59,314,726 M227K probably benign Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Phldb2 T C 16: 45,825,010 T403A probably benign Het
Plaa T C 4: 94,569,805 I643V probably benign Het
Stau1 T C 2: 166,955,016 I154V possibly damaging Het
Ugcg T G 4: 59,213,922 V168G probably damaging Het
Vmn2r2 T C 3: 64,134,632 I221V probably benign Het
Wdr93 T C 7: 79,752,493 I180T possibly damaging Het
Wnt5a T A 14: 28,513,183 Y41* probably null Het
Other mutations in Whamm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Whamm APN 7 81578266 missense probably damaging 1.00
IGL01139:Whamm APN 7 81595914 missense probably damaging 1.00
IGL01870:Whamm APN 7 81595974 missense probably damaging 0.96
IGL03153:Whamm APN 7 81589532 splice site probably benign
R0179:Whamm UTSW 7 81594015 missense probably benign 0.00
R0364:Whamm UTSW 7 81594051 missense probably benign 0.00
R0550:Whamm UTSW 7 81586224 missense possibly damaging 0.55
R0682:Whamm UTSW 7 81586138 missense probably damaging 1.00
R1388:Whamm UTSW 7 81586290 missense probably damaging 1.00
R1940:Whamm UTSW 7 81578299 missense probably null 0.94
R1991:Whamm UTSW 7 81591771 nonsense probably null
R1992:Whamm UTSW 7 81591771 nonsense probably null
R2103:Whamm UTSW 7 81591771 nonsense probably null
R2104:Whamm UTSW 7 81591771 nonsense probably null
R2162:Whamm UTSW 7 81571341 missense probably damaging 1.00
R2291:Whamm UTSW 7 81591771 nonsense probably null
R4735:Whamm UTSW 7 81571374 missense probably benign 0.01
R6336:Whamm UTSW 7 81591764 missense probably damaging 1.00
R6723:Whamm UTSW 7 81596120 missense probably damaging 1.00
R6747:Whamm UTSW 7 81578302 critical splice donor site probably null
R7029:Whamm UTSW 7 81591826 missense probably benign 0.09
R7286:Whamm UTSW 7 81586247 missense probably damaging 0.98
R7525:Whamm UTSW 7 81593850 missense probably damaging 1.00
R7732:Whamm UTSW 7 81571424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGCTGCGTTTCCTGGTG -3'
(R):5'- CCACCGTGTTTCAACTTCAAG -3'

Sequencing Primer
(F):5'- CAGTTCGCCGTCACCTG -3'
(R):5'- TCTCTCTCAACAGAGGCGCAG -3'
Posted On2015-02-05