Incidental Mutation 'R3078:Mnt'
ID265301
Institutional Source Beutler Lab
Gene Symbol Mnt
Ensembl Gene ENSMUSG00000000282
Gene Namemax binding protein
SynonymsbHLHd3, Rox
MMRRC Submission 040568-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R3078 (G1)
Quality Score136
Status Not validated
Chromosome11
Chromosomal Location74830920-74845725 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to C at 74843110 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000291] [ENSMUST00000132150]
Predicted Effect unknown
Transcript: ENSMUST00000000291
AA Change: Q522H
SMART Domains Protein: ENSMUSP00000000291
Gene: ENSMUSG00000000282
AA Change: Q522H

DomainStartEndE-ValueType
coiled coil region 3 53 N/A INTRINSIC
low complexity region 64 88 N/A INTRINSIC
low complexity region 100 125 N/A INTRINSIC
low complexity region 182 205 N/A INTRINSIC
HLH 228 279 2.99e-13 SMART
low complexity region 368 431 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 515 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132150
SMART Domains Protein: ENSMUSP00000118435
Gene: ENSMUSG00000000282

DomainStartEndE-ValueType
HLH 1 47 2.92e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Myc/Max/Mad network comprises a group of transcription factors that co-interact to regulate gene-specific transcriptional activation or repression. This gene encodes a protein member of the Myc/Max/Mad network. This protein has a basic-Helix-Loop-Helix-zipper domain (bHLHzip) with which it binds the canonical DNA sequence CANNTG, known as the E box, following heterodimerization with Max proteins. This protein is likely a transcriptional repressor and an antagonist of Myc-dependent transcriptional activation and cell growth. This protein represses transcription by binding to DNA binding proteins at its N-terminal Sin3-interaction domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a targeted null mutation are runted at birth and die within a few days, while mutant fibroblasts show abnormal cell cycling. Those homozygotes that survive are fertile and attain normal Heterozygotes for a conditional mammary epithelial specific knockout develop adenocarcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G C 5: 24,546,666 T528S probably benign Het
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Actr3b A G 5: 25,822,442 Y37C probably damaging Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Alg10b T C 15: 90,227,936 S328P probably benign Het
C5ar2 G A 7: 16,237,424 R193C probably damaging Het
Cct8 A G 16: 87,488,877 V231A possibly damaging Het
Clca4a C T 3: 144,968,253 M240I probably damaging Het
Cmya5 A T 13: 93,048,927 I3520N probably damaging Het
Dock6 G T 9: 21,845,754 probably benign Het
Dynlrb1 T A 2: 155,249,945 I99N probably damaging Het
Ebf4 G A 2: 130,306,499 D77N probably damaging Het
Fam196a A G 7: 134,918,021 I260T probably benign Het
Fbxw10 C T 11: 62,867,513 probably benign Het
Gm10801 T C 2: 98,663,852 I113T probably damaging Het
Gm14085 T C 2: 122,514,414 L167P possibly damaging Het
Gm5499 T C 17: 87,078,886 noncoding transcript Het
Gm9913 A G 2: 125,506,539 probably benign Het
Herc2 A G 7: 56,137,243 N1612S probably benign Het
Ifnar2 T C 16: 91,386,001 S53P possibly damaging Het
Inpp5j T A 11: 3,503,124 probably null Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Med28 A G 5: 45,522,478 T68A possibly damaging Het
Meis1 A T 11: 19,011,254 N206K probably benign Het
Mfsd14a T C 3: 116,647,917 probably benign Het
Mto1 A G 9: 78,458,028 Y413C probably damaging Het
Myo7b T C 18: 31,967,184 D1599G probably benign Het
Myoz1 T C 14: 20,653,617 probably benign Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Npr2 T A 4: 43,640,182 Y306N probably damaging Het
Nrxn3 T G 12: 89,260,416 C274G probably damaging Het
Olfr204 A T 16: 59,314,726 M227K probably benign Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Phldb2 T C 16: 45,825,010 T403A probably benign Het
Plaa T C 4: 94,569,805 I643V probably benign Het
Stau1 T C 2: 166,955,016 I154V possibly damaging Het
Ugcg T G 4: 59,213,922 V168G probably damaging Het
Vmn2r2 T C 3: 64,134,632 I221V probably benign Het
Wdr93 T C 7: 79,752,493 I180T possibly damaging Het
Whamm G C 7: 81,571,784 G155R probably damaging Het
Wnt5a T A 14: 28,513,183 Y41* probably null Het
Other mutations in Mnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mnt APN 11 74842185 missense probably damaging 1.00
R0599:Mnt UTSW 11 74842296 missense probably benign 0.09
R2100:Mnt UTSW 11 74831351 missense probably damaging 1.00
R3076:Mnt UTSW 11 74843110 intron probably benign
R3077:Mnt UTSW 11 74843110 intron probably benign
R3605:Mnt UTSW 11 74836920 missense possibly damaging 0.89
R4601:Mnt UTSW 11 74836459 missense possibly damaging 0.76
R5766:Mnt UTSW 11 74843078 intron probably benign
R6340:Mnt UTSW 11 74836416 missense probably damaging 1.00
R6988:Mnt UTSW 11 74842809 intron probably benign
R7460:Mnt UTSW 11 74843283 missense unknown
Z1176:Mnt UTSW 11 74836675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGACTGTGAACCATGTTCTGC -3'
(R):5'- TGAGTGTGCTGACCGGAAAG -3'

Sequencing Primer
(F):5'- ATGTTCTGCAGGGGCCG -3'
(R):5'- CTGACCGGAAAGGAGGGC -3'
Posted On2015-02-05