Incidental Mutation 'R3078:Wnt5a'
ID 265306
Institutional Source Beutler Lab
Gene Symbol Wnt5a
Ensembl Gene ENSMUSG00000021994
Gene Name wingless-type MMTV integration site family, member 5A
Synonyms 8030457G12Rik, Wnt-5a
MMRRC Submission 040568-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3078 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 28226707-28249405 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 28235140 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 41 (Y41*)
Ref Sequence ENSEMBL: ENSMUSP00000107891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063465] [ENSMUST00000112272]
AlphaFold P22725
Predicted Effect probably null
Transcript: ENSMUST00000063465
AA Change: Y61*
SMART Domains Protein: ENSMUSP00000064878
Gene: ENSMUSG00000021994
AA Change: Y61*

DomainStartEndE-ValueType
Blast:WNT1 1 46 7e-6 BLAST
WNT1 71 380 6.71e-222 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112272
AA Change: Y41*
SMART Domains Protein: ENSMUSP00000107891
Gene: ENSMUSG00000021994
AA Change: Y41*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WNT1 51 360 6.71e-222 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146192
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180668
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants exhibit caudal truncation with shortened anterior-posterior axis, truncation of the snout, tongue and mandible, short fore- and hindlimbs, which lack digits, absent genital tubercle and lung abnormalities. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,306,764 (GRCm39) I1981V probably benign Het
Actr3b A G 5: 26,027,440 (GRCm39) Y37C probably damaging Het
Adgrd1 A T 5: 129,206,169 (GRCm39) I248F probably benign Het
Alg10b T C 15: 90,112,139 (GRCm39) S328P probably benign Het
C5ar2 G A 7: 15,971,349 (GRCm39) R193C probably damaging Het
Cct8 A G 16: 87,285,765 (GRCm39) V231A possibly damaging Het
Clca4a C T 3: 144,674,014 (GRCm39) M240I probably damaging Het
Cmya5 A T 13: 93,185,435 (GRCm39) I3520N probably damaging Het
Dock6 G T 9: 21,757,050 (GRCm39) probably benign Het
Dynlrb1 T A 2: 155,091,865 (GRCm39) I99N probably damaging Het
Ebf4 G A 2: 130,148,419 (GRCm39) D77N probably damaging Het
Fbxw10 C T 11: 62,758,339 (GRCm39) probably benign Het
Gm10801 T C 2: 98,494,197 (GRCm39) I113T probably damaging Het
Gm5499 T C 17: 87,386,314 (GRCm39) noncoding transcript Het
Gm9913 A G 2: 125,348,459 (GRCm39) probably benign Het
Herc2 A G 7: 55,786,991 (GRCm39) N1612S probably benign Het
Ifnar2 T C 16: 91,182,889 (GRCm39) S53P possibly damaging Het
Inpp5j T A 11: 3,453,124 (GRCm39) probably null Het
Insyn2a A G 7: 134,519,750 (GRCm39) I260T probably benign Het
Iqca1l G C 5: 24,751,664 (GRCm39) T528S probably benign Het
Kif14 T G 1: 136,447,383 (GRCm39) I1396S possibly damaging Het
Med28 A G 5: 45,679,820 (GRCm39) T68A possibly damaging Het
Meis1 A T 11: 18,961,254 (GRCm39) N206K probably benign Het
Mfsd14a T C 3: 116,441,566 (GRCm39) probably benign Het
Mnt G C 11: 74,733,936 (GRCm39) probably benign Het
Mto1 A G 9: 78,365,310 (GRCm39) Y413C probably damaging Het
Myo7b T C 18: 32,100,237 (GRCm39) D1599G probably benign Het
Myoz1 T C 14: 20,703,685 (GRCm39) probably benign Het
Nhsl2 C T X: 101,121,201 (GRCm39) R62W probably damaging Het
Npr2 T A 4: 43,640,182 (GRCm39) Y306N probably damaging Het
Nrxn3 T G 12: 89,227,186 (GRCm39) C274G probably damaging Het
Or1e29 G A 11: 73,667,466 (GRCm39) P229L possibly damaging Het
Or5ac22 A T 16: 59,135,089 (GRCm39) M227K probably benign Het
Phldb2 T C 16: 45,645,373 (GRCm39) T403A probably benign Het
Plaa T C 4: 94,458,042 (GRCm39) I643V probably benign Het
Slc28a2b T C 2: 122,344,895 (GRCm39) L167P possibly damaging Het
Stau1 T C 2: 166,796,936 (GRCm39) I154V possibly damaging Het
Ugcg T G 4: 59,213,922 (GRCm39) V168G probably damaging Het
Vmn2r2 T C 3: 64,042,053 (GRCm39) I221V probably benign Het
Wdr93 T C 7: 79,402,241 (GRCm39) I180T possibly damaging Het
Whamm G C 7: 81,221,532 (GRCm39) G155R probably damaging Het
Other mutations in Wnt5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Wnt5a APN 14 28,244,866 (GRCm39) missense probably damaging 1.00
IGL01945:Wnt5a APN 14 28,240,519 (GRCm39) missense probably damaging 1.00
IGL02117:Wnt5a APN 14 28,228,077 (GRCm39) splice site probably benign
IGL02995:Wnt5a APN 14 28,244,871 (GRCm39) missense probably benign 0.02
IGL03123:Wnt5a APN 14 28,244,882 (GRCm39) missense probably damaging 1.00
Thrush UTSW 14 28,240,420 (GRCm39) missense possibly damaging 0.78
R0254:Wnt5a UTSW 14 28,244,811 (GRCm39) missense probably damaging 1.00
R0277:Wnt5a UTSW 14 28,235,225 (GRCm39) missense possibly damaging 0.74
R0365:Wnt5a UTSW 14 28,240,461 (GRCm39) nonsense probably null
R1472:Wnt5a UTSW 14 28,240,461 (GRCm39) nonsense probably null
R1661:Wnt5a UTSW 14 28,240,300 (GRCm39) missense probably benign 0.02
R1662:Wnt5a UTSW 14 28,240,300 (GRCm39) missense probably benign 0.02
R1762:Wnt5a UTSW 14 28,244,848 (GRCm39) missense probably damaging 1.00
R1791:Wnt5a UTSW 14 28,233,835 (GRCm39) start codon destroyed probably null 0.00
R1933:Wnt5a UTSW 14 28,233,802 (GRCm39) missense probably benign 0.00
R2147:Wnt5a UTSW 14 28,235,274 (GRCm39) missense probably damaging 1.00
R2149:Wnt5a UTSW 14 28,235,274 (GRCm39) missense probably damaging 1.00
R3162:Wnt5a UTSW 14 28,244,445 (GRCm39) missense probably benign 0.00
R3162:Wnt5a UTSW 14 28,244,445 (GRCm39) missense probably benign 0.00
R4237:Wnt5a UTSW 14 28,244,823 (GRCm39) missense probably damaging 1.00
R5396:Wnt5a UTSW 14 28,244,727 (GRCm39) missense probably damaging 1.00
R6329:Wnt5a UTSW 14 28,240,449 (GRCm39) nonsense probably null
R6698:Wnt5a UTSW 14 28,240,420 (GRCm39) missense possibly damaging 0.78
R6974:Wnt5a UTSW 14 28,244,527 (GRCm39) missense possibly damaging 0.89
R7114:Wnt5a UTSW 14 28,244,713 (GRCm39) missense probably damaging 1.00
R7232:Wnt5a UTSW 14 28,240,329 (GRCm39) missense probably benign 0.03
R7457:Wnt5a UTSW 14 28,240,236 (GRCm39) splice site probably null
R7666:Wnt5a UTSW 14 28,240,329 (GRCm39) missense possibly damaging 0.88
R8273:Wnt5a UTSW 14 28,244,562 (GRCm39) missense probably damaging 1.00
R8349:Wnt5a UTSW 14 28,235,108 (GRCm39) missense probably benign 0.00
R8449:Wnt5a UTSW 14 28,235,108 (GRCm39) missense probably benign 0.00
R9135:Wnt5a UTSW 14 28,240,309 (GRCm39) missense probably benign 0.27
R9602:Wnt5a UTSW 14 28,240,295 (GRCm39) missense probably benign 0.31
T0722:Wnt5a UTSW 14 28,233,882 (GRCm39) missense probably benign 0.01
Z1088:Wnt5a UTSW 14 28,244,685 (GRCm39) missense probably damaging 0.99
Z1176:Wnt5a UTSW 14 28,233,864 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCAGGGTTTAAACAGAGG -3'
(R):5'- GAAGTATTGTCCACTGTGCTGC -3'

Sequencing Primer
(F):5'- CAGAGGAGTTCTATGAAGCCCTTC -3'
(R):5'- GCTGCAGTTCCATCTCCGATG -3'
Posted On 2015-02-05