Incidental Mutation 'R3078:Olfr204'
ID265309
Institutional Source Beutler Lab
Gene Symbol Olfr204
Ensembl Gene ENSMUSG00000095928
Gene Nameolfactory receptor 204
SynonymsGA_x54KRFPKG5P-55529713-55528796, MOR182-3
MMRRC Submission 040568-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3078 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59310206-59318248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59314726 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 227 (M227K)
Ref Sequence ENSEMBL: ENSMUSP00000151176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072517] [ENSMUST00000207927] [ENSMUST00000216261]
Predicted Effect probably benign
Transcript: ENSMUST00000072517
AA Change: M227K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072332
Gene: ENSMUSG00000095928
AA Change: M227K

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 299 2.3e-9 PFAM
Pfam:7tm_1 40 289 3.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207927
AA Change: M227K
Predicted Effect probably benign
Transcript: ENSMUST00000216261
AA Change: M227K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G C 5: 24,546,666 T528S probably benign Het
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Actr3b A G 5: 25,822,442 Y37C probably damaging Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Alg10b T C 15: 90,227,936 S328P probably benign Het
C5ar2 G A 7: 16,237,424 R193C probably damaging Het
Cct8 A G 16: 87,488,877 V231A possibly damaging Het
Clca4a C T 3: 144,968,253 M240I probably damaging Het
Cmya5 A T 13: 93,048,927 I3520N probably damaging Het
Dock6 G T 9: 21,845,754 probably benign Het
Dynlrb1 T A 2: 155,249,945 I99N probably damaging Het
Ebf4 G A 2: 130,306,499 D77N probably damaging Het
Fam196a A G 7: 134,918,021 I260T probably benign Het
Fbxw10 C T 11: 62,867,513 probably benign Het
Gm10801 T C 2: 98,663,852 I113T probably damaging Het
Gm14085 T C 2: 122,514,414 L167P possibly damaging Het
Gm5499 T C 17: 87,078,886 noncoding transcript Het
Gm9913 A G 2: 125,506,539 probably benign Het
Herc2 A G 7: 56,137,243 N1612S probably benign Het
Ifnar2 T C 16: 91,386,001 S53P possibly damaging Het
Inpp5j T A 11: 3,503,124 probably null Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Med28 A G 5: 45,522,478 T68A possibly damaging Het
Meis1 A T 11: 19,011,254 N206K probably benign Het
Mfsd14a T C 3: 116,647,917 probably benign Het
Mnt G C 11: 74,843,110 probably benign Het
Mto1 A G 9: 78,458,028 Y413C probably damaging Het
Myo7b T C 18: 31,967,184 D1599G probably benign Het
Myoz1 T C 14: 20,653,617 probably benign Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Npr2 T A 4: 43,640,182 Y306N probably damaging Het
Nrxn3 T G 12: 89,260,416 C274G probably damaging Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Phldb2 T C 16: 45,825,010 T403A probably benign Het
Plaa T C 4: 94,569,805 I643V probably benign Het
Stau1 T C 2: 166,955,016 I154V possibly damaging Het
Ugcg T G 4: 59,213,922 V168G probably damaging Het
Vmn2r2 T C 3: 64,134,632 I221V probably benign Het
Wdr93 T C 7: 79,752,493 I180T possibly damaging Het
Whamm G C 7: 81,571,784 G155R probably damaging Het
Wnt5a T A 14: 28,513,183 Y41* probably null Het
Other mutations in Olfr204
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01771:Olfr204 APN 16 59314528 missense probably damaging 1.00
IGL01915:Olfr204 APN 16 59315110 missense probably damaging 1.00
R0265:Olfr204 UTSW 16 59315071 missense probably damaging 1.00
R0532:Olfr204 UTSW 16 59314601 missense probably benign 0.00
R1719:Olfr204 UTSW 16 59314706 nonsense probably null
R1864:Olfr204 UTSW 16 59315015 missense probably damaging 1.00
R1889:Olfr204 UTSW 16 59314963 missense probably damaging 0.98
R1925:Olfr204 UTSW 16 59314664 missense probably damaging 1.00
R2973:Olfr204 UTSW 16 59315404 start codon destroyed probably null 1.00
R3819:Olfr204 UTSW 16 59315071 missense probably damaging 1.00
R4036:Olfr204 UTSW 16 59314750 missense probably benign
R4698:Olfr204 UTSW 16 59315357 missense probably damaging 1.00
R4930:Olfr204 UTSW 16 59314873 missense probably damaging 1.00
R5457:Olfr204 UTSW 16 59314850 missense probably benign 0.12
R6597:Olfr204 UTSW 16 59315350 missense probably benign 0.00
R7341:Olfr204 UTSW 16 59315149 missense possibly damaging 0.69
R7512:Olfr204 UTSW 16 59315027 missense probably damaging 0.99
R7702:Olfr204 UTSW 16 59314634 missense probably damaging 1.00
R8132:Olfr204 UTSW 16 59314544 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GGTTTAGCAGAGGAATCACAAC -3'
(R):5'- TGTCCAAGAGACTCTGTACTGTG -3'

Sequencing Primer
(F):5'- TTAGCAGAGGAATCACAACTGTGTAG -3'
(R):5'- CCAAGAGACTCTGTACTGTGTTAATC -3'
Posted On2015-02-05