Incidental Mutation 'R3078:Ifnar2'
ID265311
Institutional Source Beutler Lab
Gene Symbol Ifnar2
Ensembl Gene ENSMUSG00000022971
Gene Nameinterferon (alpha and beta) receptor 2
SynonymsIfnar-2
MMRRC Submission 040568-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R3078 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91372783-91405589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91386001 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 53 (S53P)
Ref Sequence ENSEMBL: ENSMUSP00000113358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023693] [ENSMUST00000089042] [ENSMUST00000117836] [ENSMUST00000134491] [ENSMUST00000139503]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023693
AA Change: S53P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023693
Gene: ENSMUSG00000022971
AA Change: S53P

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 8.9e-18 PFAM
Pfam:Interfer-bind 132 231 9.2e-19 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 361 389 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000089042
AA Change: S53P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000086443
Gene: ENSMUSG00000022971
AA Change: S53P

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 2.9e-18 PFAM
Pfam:Interfer-bind 132 231 1.5e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117836
AA Change: S53P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113358
Gene: ENSMUSG00000022971
AA Change: S53P

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 2.9e-18 PFAM
Pfam:Interfer-bind 132 231 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134491
SMART Domains Protein: ENSMUSP00000134796
Gene: ENSMUSG00000022971

DomainStartEndE-ValueType
Pfam:Interfer-bind 30 117 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139503
Meta Mutation Damage Score 0.5764 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. Multiple transcript variants encoding at least two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with mutations of this gene have defects in immune responses involving, variously, NK cells, CD4+ and CD8+ T cells and B cells in response to induced and transplanted tumors, viruses, and double stranded DNA. These defects include diminished secretion of type I and type II interferons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G C 5: 24,546,666 T528S probably benign Het
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Actr3b A G 5: 25,822,442 Y37C probably damaging Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Alg10b T C 15: 90,227,936 S328P probably benign Het
C5ar2 G A 7: 16,237,424 R193C probably damaging Het
Cct8 A G 16: 87,488,877 V231A possibly damaging Het
Clca4a C T 3: 144,968,253 M240I probably damaging Het
Cmya5 A T 13: 93,048,927 I3520N probably damaging Het
Dock6 G T 9: 21,845,754 probably benign Het
Dynlrb1 T A 2: 155,249,945 I99N probably damaging Het
Ebf4 G A 2: 130,306,499 D77N probably damaging Het
Fam196a A G 7: 134,918,021 I260T probably benign Het
Fbxw10 C T 11: 62,867,513 probably benign Het
Gm10801 T C 2: 98,663,852 I113T probably damaging Het
Gm14085 T C 2: 122,514,414 L167P possibly damaging Het
Gm5499 T C 17: 87,078,886 noncoding transcript Het
Gm9913 A G 2: 125,506,539 probably benign Het
Herc2 A G 7: 56,137,243 N1612S probably benign Het
Inpp5j T A 11: 3,503,124 probably null Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Med28 A G 5: 45,522,478 T68A possibly damaging Het
Meis1 A T 11: 19,011,254 N206K probably benign Het
Mfsd14a T C 3: 116,647,917 probably benign Het
Mnt G C 11: 74,843,110 probably benign Het
Mto1 A G 9: 78,458,028 Y413C probably damaging Het
Myo7b T C 18: 31,967,184 D1599G probably benign Het
Myoz1 T C 14: 20,653,617 probably benign Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Npr2 T A 4: 43,640,182 Y306N probably damaging Het
Nrxn3 T G 12: 89,260,416 C274G probably damaging Het
Olfr204 A T 16: 59,314,726 M227K probably benign Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Phldb2 T C 16: 45,825,010 T403A probably benign Het
Plaa T C 4: 94,569,805 I643V probably benign Het
Stau1 T C 2: 166,955,016 I154V possibly damaging Het
Ugcg T G 4: 59,213,922 V168G probably damaging Het
Vmn2r2 T C 3: 64,134,632 I221V probably benign Het
Wdr93 T C 7: 79,752,493 I180T possibly damaging Het
Whamm G C 7: 81,571,784 G155R probably damaging Het
Wnt5a T A 14: 28,513,183 Y41* probably null Het
Other mutations in Ifnar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Ifnar2 APN 16 91391711 unclassified probably benign
IGL02817:Ifnar2 APN 16 91387992 missense probably benign 0.01
macro-2 UTSW 16 91383899 start codon destroyed probably null
R0701:Ifnar2 UTSW 16 91404229 missense possibly damaging 0.53
R1342:Ifnar2 UTSW 16 91403921 missense possibly damaging 0.85
R1542:Ifnar2 UTSW 16 91399265 missense possibly damaging 0.95
R1631:Ifnar2 UTSW 16 91391867 missense probably benign 0.00
R1913:Ifnar2 UTSW 16 91404170 missense probably benign 0.33
R4193:Ifnar2 UTSW 16 91404344 missense probably damaging 0.98
R4592:Ifnar2 UTSW 16 91391796 missense probably benign
R5385:Ifnar2 UTSW 16 91404198 missense possibly damaging 0.70
R5545:Ifnar2 UTSW 16 91385025 critical splice donor site probably null
R5645:Ifnar2 UTSW 16 91404227 missense possibly damaging 0.85
R6223:Ifnar2 UTSW 16 91387988 missense probably damaging 0.98
R6371:Ifnar2 UTSW 16 91388098 missense possibly damaging 0.95
R6710:Ifnar2 UTSW 16 91393883 missense probably damaging 0.98
R6929:Ifnar2 UTSW 16 91393878 nonsense probably null
R7530:Ifnar2 UTSW 16 91404313 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TCCAGTGGACTTCCTGCTTG -3'
(R):5'- TTCTGGGGCAGGAAGTATGC -3'

Sequencing Primer
(F):5'- TAAGTGCCAGAATGCTTCCACTAGG -3'
(R):5'- GCAGGAAGTATGCCTAGCG -3'
Posted On2015-02-05