Incidental Mutation 'R3078:Nhsl2'
ID265314
Institutional Source Beutler Lab
Gene Symbol Nhsl2
Ensembl Gene ENSMUSG00000079481
Gene NameNHS-like 2
SynonymsGm10456, 1110062M06Rik
MMRRC Submission 040568-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.043) question?
Stock #R3078 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location101849385-102092055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102077595 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 62 (R62W)
Ref Sequence ENSEMBL: ENSMUSP00000143176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101339] [ENSMUST00000124279] [ENSMUST00000144753]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101339
AA Change: R335W

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098893
Gene: ENSMUSG00000079481
AA Change: R335W

DomainStartEndE-ValueType
low complexity region 48 62 N/A INTRINSIC
low complexity region 68 84 N/A INTRINSIC
low complexity region 135 155 N/A INTRINSIC
Pfam:NHS 494 613 3.8e-11 PFAM
Pfam:NHS 607 771 1.5e-25 PFAM
low complexity region 827 836 N/A INTRINSIC
low complexity region 935 952 N/A INTRINSIC
low complexity region 989 1002 N/A INTRINSIC
low complexity region 1145 1160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124279
SMART Domains Protein: ENSMUSP00000116112
Gene: ENSMUSG00000079481

DomainStartEndE-ValueType
low complexity region 48 62 N/A INTRINSIC
low complexity region 68 94 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129185
Predicted Effect probably damaging
Transcript: ENSMUST00000144753
AA Change: R62W

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155477
Meta Mutation Damage Score 0.1125 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 93% (42/45)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G C 5: 24,546,666 T528S probably benign Het
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Actr3b A G 5: 25,822,442 Y37C probably damaging Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Alg10b T C 15: 90,227,936 S328P probably benign Het
C5ar2 G A 7: 16,237,424 R193C probably damaging Het
Cct8 A G 16: 87,488,877 V231A possibly damaging Het
Clca4a C T 3: 144,968,253 M240I probably damaging Het
Cmya5 A T 13: 93,048,927 I3520N probably damaging Het
Dock6 G T 9: 21,845,754 probably benign Het
Dynlrb1 T A 2: 155,249,945 I99N probably damaging Het
Ebf4 G A 2: 130,306,499 D77N probably damaging Het
Fam196a A G 7: 134,918,021 I260T probably benign Het
Fbxw10 C T 11: 62,867,513 probably benign Het
Gm10801 T C 2: 98,663,852 I113T probably damaging Het
Gm14085 T C 2: 122,514,414 L167P possibly damaging Het
Gm5499 T C 17: 87,078,886 noncoding transcript Het
Gm9913 A G 2: 125,506,539 probably benign Het
Herc2 A G 7: 56,137,243 N1612S probably benign Het
Ifnar2 T C 16: 91,386,001 S53P possibly damaging Het
Inpp5j T A 11: 3,503,124 probably null Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Med28 A G 5: 45,522,478 T68A possibly damaging Het
Meis1 A T 11: 19,011,254 N206K probably benign Het
Mfsd14a T C 3: 116,647,917 probably benign Het
Mnt G C 11: 74,843,110 probably benign Het
Mto1 A G 9: 78,458,028 Y413C probably damaging Het
Myo7b T C 18: 31,967,184 D1599G probably benign Het
Myoz1 T C 14: 20,653,617 probably benign Het
Npr2 T A 4: 43,640,182 Y306N probably damaging Het
Nrxn3 T G 12: 89,260,416 C274G probably damaging Het
Olfr204 A T 16: 59,314,726 M227K probably benign Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Phldb2 T C 16: 45,825,010 T403A probably benign Het
Plaa T C 4: 94,569,805 I643V probably benign Het
Stau1 T C 2: 166,955,016 I154V possibly damaging Het
Ugcg T G 4: 59,213,922 V168G probably damaging Het
Vmn2r2 T C 3: 64,134,632 I221V probably benign Het
Wdr93 T C 7: 79,752,493 I180T possibly damaging Het
Whamm G C 7: 81,571,784 G155R probably damaging Het
Wnt5a T A 14: 28,513,183 Y41* probably null Het
Other mutations in Nhsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Nhsl2 APN X 102078252 missense probably damaging 1.00
IGL02901:Nhsl2 APN X 102079243 missense probably benign 0.25
IGL03038:Nhsl2 APN X 102078885 missense probably damaging 1.00
IGL03120:Nhsl2 APN X 102071333 missense probably benign 0.14
IGL03144:Nhsl2 APN X 102079509 missense possibly damaging 0.94
R3076:Nhsl2 UTSW X 102077595 missense probably damaging 0.98
R3077:Nhsl2 UTSW X 102077595 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAGCTGTTGGCAAGTGGTG -3'
(R):5'- AAGCATCTCCCTTCCAGGAAG -3'

Sequencing Primer
(F):5'- GTTCTTGTCACAAAGCAGCTG -3'
(R):5'- CAGGAAGTGGAGAATGTTGACTCTG -3'
Posted On2015-02-05