Incidental Mutation 'R3079:Elp4'
ID265320
Institutional Source Beutler Lab
Gene Symbol Elp4
Ensembl Gene ENSMUSG00000027167
Gene Nameelongator acetyltransferase complex subunit 4
SynonymsA330107A17Rik, Paxneb
MMRRC Submission 040569-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R3079 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location105701027-105904564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105809445 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 130 (K130E)
Ref Sequence ENSEMBL: ENSMUSP00000028588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028588] [ENSMUST00000122965]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028588
AA Change: K130E

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028588
Gene: ENSMUSG00000027167
AA Change: K130E

DomainStartEndE-ValueType
Pfam:PAXNEB 2 270 9.1e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122965
AA Change: K248E

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116575
Gene: ENSMUSG00000027167
AA Change: K248E

DomainStartEndE-ValueType
Pfam:PAXNEB 28 422 4e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152272
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the six subunit elongator complex, a histone acetyltransferase complex that associates directly with RNA polymerase II during transcriptional elongation. The human gene can partially complement sensitivity phenotypes of yeast ELP4 deletion mutants. This gene has also been associated with Rolandic epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A T 15: 102,340,444 L168H probably damaging Het
Abca15 T C 7: 120,385,169 W1158R probably damaging Het
AI481877 G T 4: 59,047,848 T1257N possibly damaging Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Aqp11 A T 7: 97,737,588 C134S probably benign Het
Arhgap35 A G 7: 16,562,576 Y855H probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Cit A G 5: 115,925,486 D462G probably damaging Het
Col6a6 T C 9: 105,754,223 R1494G probably benign Het
Edc4 T C 8: 105,885,118 S109P possibly damaging Het
Gemin5 A T 11: 58,145,519 V666E probably damaging Het
Gm13128 T G 4: 144,331,528 L235R probably damaging Het
Hba-x A G 11: 32,277,616 D62G probably damaging Het
Hnrnpul1 A T 7: 25,733,115 Y474* probably null Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Mrc2 T C 11: 105,336,713 S591P probably damaging Het
Msh5 T C 17: 35,046,232 E48G probably benign Het
Mybpc2 T C 7: 44,506,081 D916G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nlrp1b T C 11: 71,217,968 R236G probably benign Het
Obsl1 G T 1: 75,490,823 R1436S probably damaging Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr576 C T 7: 102,973,047 probably null Het
Padi2 T C 4: 140,949,878 V659A probably damaging Het
Pnpla6 T G 8: 3,541,512 S1169A probably benign Het
Pqlc2 G T 4: 139,306,518 A30D probably damaging Het
Prl6a1 A G 13: 27,319,000 D193G possibly damaging Het
Rce1 G T 19: 4,624,722 C138* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint2 A G 4: 112,639,673 T259A probably benign Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Slfn1 T C 11: 83,121,160 V34A probably benign Het
Syt4 A G 18: 31,441,685 V293A probably benign Het
Trh T C 6: 92,242,570 E255G possibly damaging Het
Ube4a G T 9: 44,960,073 N9K probably damaging Het
Uck1 A T 2: 32,258,077 probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Wbp2 C T 11: 116,079,708 probably null Het
Zdbf2 A G 1: 63,307,477 I1672V probably benign Het
Other mutations in Elp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Elp4 APN 2 105842366 splice site probably benign
IGL01407:Elp4 APN 2 105792308 missense probably damaging 1.00
IGL02173:Elp4 APN 2 105702743 missense probably damaging 0.96
IGL02370:Elp4 APN 2 105794592 missense probably damaging 1.00
R0125:Elp4 UTSW 2 105792214 critical splice donor site probably null
R0685:Elp4 UTSW 2 105792277 missense possibly damaging 0.94
R0893:Elp4 UTSW 2 105896945 splice site probably benign
R1117:Elp4 UTSW 2 105842311 missense probably benign 0.00
R1496:Elp4 UTSW 2 105832161 missense probably benign 0.31
R1542:Elp4 UTSW 2 105794609 missense probably benign 0.02
R1911:Elp4 UTSW 2 105702743 missense probably damaging 0.96
R2311:Elp4 UTSW 2 105842332 missense probably benign 0.00
R2997:Elp4 UTSW 2 105814316 missense possibly damaging 0.82
R3683:Elp4 UTSW 2 105702761 missense possibly damaging 0.75
R4747:Elp4 UTSW 2 105794607 missense probably damaging 1.00
R4799:Elp4 UTSW 2 105809267 missense probably damaging 0.99
R5438:Elp4 UTSW 2 105904403 missense probably damaging 1.00
R5635:Elp4 UTSW 2 105814264 critical splice donor site probably null
R6414:Elp4 UTSW 2 105904443 missense possibly damaging 0.94
R7228:Elp4 UTSW 2 105792302 missense probably damaging 1.00
R7381:Elp4 UTSW 2 105792307 missense not run
R7560:Elp4 UTSW 2 105794588 missense probably damaging 1.00
R7671:Elp4 UTSW 2 105904481 missense probably damaging 0.99
R8376:Elp4 UTSW 2 105842308 missense probably benign 0.00
R8918:Elp4 UTSW 2 105832255 missense not run
Predicted Primers PCR Primer
(F):5'- GTCTTACCTGGACAAGATGTGC -3'
(R):5'- GTGTACCAAACTGGATTTGTCC -3'

Sequencing Primer
(F):5'- CTGGACAAGATGTGCTGGCATC -3'
(R):5'- ACCAAACTGGATTTGTCCTATTTTC -3'
Posted On2015-02-05