Incidental Mutation 'R3079:Gm13128'
ID265325
Institutional Source Beutler Lab
Gene Symbol Gm13128
Ensembl Gene ENSMUSG00000078508
Gene Namepredicted gene 13128
Synonyms
MMRRC Submission 040569-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R3079 (G1)
Quality Score150
Status Not validated
Chromosome4
Chromosomal Location144330249-144333465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 144331528 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 235 (L235R)
Ref Sequence ENSEMBL: ENSMUSP00000101377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105751]
Predicted Effect probably damaging
Transcript: ENSMUST00000105751
AA Change: L235R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101377
Gene: ENSMUSG00000078508
AA Change: L235R

DomainStartEndE-ValueType
low complexity region 188 200 N/A INTRINSIC
SCOP:d1a4ya_ 205 408 6e-11 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A T 15: 102,340,444 L168H probably damaging Het
Abca15 T C 7: 120,385,169 W1158R probably damaging Het
AI481877 G T 4: 59,047,848 T1257N possibly damaging Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Aqp11 A T 7: 97,737,588 C134S probably benign Het
Arhgap35 A G 7: 16,562,576 Y855H probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Cit A G 5: 115,925,486 D462G probably damaging Het
Col6a6 T C 9: 105,754,223 R1494G probably benign Het
Edc4 T C 8: 105,885,118 S109P possibly damaging Het
Elp4 T C 2: 105,809,445 K130E possibly damaging Het
Gemin5 A T 11: 58,145,519 V666E probably damaging Het
Hba-x A G 11: 32,277,616 D62G probably damaging Het
Hnrnpul1 A T 7: 25,733,115 Y474* probably null Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Mrc2 T C 11: 105,336,713 S591P probably damaging Het
Msh5 T C 17: 35,046,232 E48G probably benign Het
Mybpc2 T C 7: 44,506,081 D916G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nlrp1b T C 11: 71,217,968 R236G probably benign Het
Obsl1 G T 1: 75,490,823 R1436S probably damaging Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr576 C T 7: 102,973,047 probably null Het
Padi2 T C 4: 140,949,878 V659A probably damaging Het
Pnpla6 T G 8: 3,541,512 S1169A probably benign Het
Pqlc2 G T 4: 139,306,518 A30D probably damaging Het
Prl6a1 A G 13: 27,319,000 D193G possibly damaging Het
Rce1 G T 19: 4,624,722 C138* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint2 A G 4: 112,639,673 T259A probably benign Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Slfn1 T C 11: 83,121,160 V34A probably benign Het
Syt4 A G 18: 31,441,685 V293A probably benign Het
Trh T C 6: 92,242,570 E255G possibly damaging Het
Ube4a G T 9: 44,960,073 N9K probably damaging Het
Uck1 A T 2: 32,258,077 probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Wbp2 C T 11: 116,079,708 probably null Het
Zdbf2 A G 1: 63,307,477 I1672V probably benign Het
Other mutations in Gm13128
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0097:Gm13128 UTSW 4 144331287 missense probably benign 0.01
R1743:Gm13128 UTSW 4 144333005 missense probably benign 0.03
R3948:Gm13128 UTSW 4 144331306 missense probably benign 0.01
R3954:Gm13128 UTSW 4 144331668 missense probably benign 0.03
R4448:Gm13128 UTSW 4 144332685 missense probably damaging 1.00
R5008:Gm13128 UTSW 4 144331266 missense probably benign 0.02
R5715:Gm13128 UTSW 4 144331300 missense possibly damaging 0.67
R5986:Gm13128 UTSW 4 144332753 missense probably damaging 0.98
R6008:Gm13128 UTSW 4 144331207 missense probably benign 0.08
R6278:Gm13128 UTSW 4 144330267 missense probably damaging 0.98
R6383:Gm13128 UTSW 4 144333147 makesense probably null
R6523:Gm13128 UTSW 4 144331648 missense probably benign 0.42
R6747:Gm13128 UTSW 4 144332978 missense probably benign 0.00
R7276:Gm13128 UTSW 4 144332646 missense possibly damaging 0.67
R7555:Gm13128 UTSW 4 144332741 missense probably benign 0.01
R8213:Gm13128 UTSW 4 144330460 missense probably benign 0.03
Z1177:Gm13128 UTSW 4 144331193 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACATTTGTTGCAGTGGGC -3'
(R):5'- TGGTAACAGCAACAGTACTTCATCC -3'

Sequencing Primer
(F):5'- ACAGAGAGGGTTTCCTGCATC -3'
(R):5'- AGCAACAGTACTTCATCCTTTCTTAC -3'
Posted On2015-02-05