Incidental Mutation 'R3079:Pnpla6'
ID265336
Institutional Source Beutler Lab
Gene Symbol Pnpla6
Ensembl Gene ENSMUSG00000004565
Gene Namepatatin-like phospholipase domain containing 6
SynonymsNte, Swiss-cheese, MSws
MMRRC Submission 040569-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3079 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location3515384-3544267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 3541512 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 1169 (S1169A)
Ref Sequence ENSEMBL: ENSMUSP00000106699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004681] [ENSMUST00000111070] [ENSMUST00000207421] [ENSMUST00000207941] [ENSMUST00000208002]
Predicted Effect probably benign
Transcript: ENSMUST00000004681
AA Change: S1169A

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000004681
Gene: ENSMUSG00000004565
AA Change: S1169A

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111070
AA Change: S1169A

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106699
Gene: ENSMUSG00000004565
AA Change: S1169A

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 1.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207317
Predicted Effect unknown
Transcript: ENSMUST00000207336
AA Change: S91A
Predicted Effect probably benign
Transcript: ENSMUST00000207421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207929
Predicted Effect probably benign
Transcript: ENSMUST00000207941
AA Change: S1158A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000208002
AA Change: S1187A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208914
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase that deacetylates intracellular phosphatidylcholine to produce glycerophosphocholine. It is thought to function in neurite outgrowth and process elongation during neuronal differentiation. The protein is anchored to the cytoplasmic face of the endoplasmic reticulum in both neurons and non-neuronal cells. Mutations in this gene result in autosomal recessive spastic paraplegia, and the protein is the target for neurodegeneration induced by organophosphorus compounds and chemical warfare agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during early gestation. Conditional inactivation in the central nervous system leads to neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A T 15: 102,340,444 L168H probably damaging Het
Abca15 T C 7: 120,385,169 W1158R probably damaging Het
AI481877 G T 4: 59,047,848 T1257N possibly damaging Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Aqp11 A T 7: 97,737,588 C134S probably benign Het
Arhgap35 A G 7: 16,562,576 Y855H probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Cit A G 5: 115,925,486 D462G probably damaging Het
Col6a6 T C 9: 105,754,223 R1494G probably benign Het
Edc4 T C 8: 105,885,118 S109P possibly damaging Het
Elp4 T C 2: 105,809,445 K130E possibly damaging Het
Gemin5 A T 11: 58,145,519 V666E probably damaging Het
Gm13128 T G 4: 144,331,528 L235R probably damaging Het
Hba-x A G 11: 32,277,616 D62G probably damaging Het
Hnrnpul1 A T 7: 25,733,115 Y474* probably null Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Mrc2 T C 11: 105,336,713 S591P probably damaging Het
Msh5 T C 17: 35,046,232 E48G probably benign Het
Mybpc2 T C 7: 44,506,081 D916G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nlrp1b T C 11: 71,217,968 R236G probably benign Het
Obsl1 G T 1: 75,490,823 R1436S probably damaging Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr576 C T 7: 102,973,047 probably null Het
Padi2 T C 4: 140,949,878 V659A probably damaging Het
Pqlc2 G T 4: 139,306,518 A30D probably damaging Het
Prl6a1 A G 13: 27,319,000 D193G possibly damaging Het
Rce1 G T 19: 4,624,722 C138* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint2 A G 4: 112,639,673 T259A probably benign Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Slfn1 T C 11: 83,121,160 V34A probably benign Het
Syt4 A G 18: 31,441,685 V293A probably benign Het
Trh T C 6: 92,242,570 E255G possibly damaging Het
Ube4a G T 9: 44,960,073 N9K probably damaging Het
Uck1 A T 2: 32,258,077 probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Wbp2 C T 11: 116,079,708 probably null Het
Zdbf2 A G 1: 63,307,477 I1672V probably benign Het
Other mutations in Pnpla6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pnpla6 APN 8 3523808 missense probably damaging 1.00
IGL00820:Pnpla6 APN 8 3532358 missense possibly damaging 0.95
IGL00839:Pnpla6 APN 8 3542299 missense probably benign 0.05
IGL01732:Pnpla6 APN 8 3522616 missense probably damaging 0.99
IGL01973:Pnpla6 APN 8 3517619 missense probably damaging 1.00
IGL02267:Pnpla6 APN 8 3517327 missense probably benign 0.00
IGL03246:Pnpla6 APN 8 3531530 missense probably benign 0.01
IGL03286:Pnpla6 APN 8 3531473 missense probably damaging 0.99
I0000:Pnpla6 UTSW 8 3542322 missense probably benign
R0141:Pnpla6 UTSW 8 3532117 critical splice donor site probably null
R0180:Pnpla6 UTSW 8 3524250 critical splice acceptor site probably null
R0377:Pnpla6 UTSW 8 3541501 missense probably damaging 1.00
R0563:Pnpla6 UTSW 8 3523333 missense possibly damaging 0.51
R0660:Pnpla6 UTSW 8 3522269 unclassified probably benign
R0786:Pnpla6 UTSW 8 3523317 missense probably benign
R0827:Pnpla6 UTSW 8 3517618 missense possibly damaging 0.71
R0882:Pnpla6 UTSW 8 3517081 missense probably damaging 1.00
R1512:Pnpla6 UTSW 8 3535459 splice site probably benign
R1552:Pnpla6 UTSW 8 3522403 missense probably damaging 1.00
R1609:Pnpla6 UTSW 8 3517135 missense probably damaging 1.00
R1770:Pnpla6 UTSW 8 3534634 missense possibly damaging 0.94
R1779:Pnpla6 UTSW 8 3541404 missense probably damaging 1.00
R1987:Pnpla6 UTSW 8 3542370 missense probably benign 0.00
R3125:Pnpla6 UTSW 8 3534670 missense probably null 1.00
R4171:Pnpla6 UTSW 8 3543997 missense probably benign 0.09
R4281:Pnpla6 UTSW 8 3521513 missense probably damaging 1.00
R4674:Pnpla6 UTSW 8 3521412 missense probably damaging 1.00
R4776:Pnpla6 UTSW 8 3523818 missense probably benign 0.01
R4779:Pnpla6 UTSW 8 3522838 missense probably benign 0.00
R5114:Pnpla6 UTSW 8 3522613 missense probably damaging 0.98
R5459:Pnpla6 UTSW 8 3535829 missense probably benign 0.01
R5510:Pnpla6 UTSW 8 3521397 missense probably damaging 0.99
R5538:Pnpla6 UTSW 8 3531508 missense probably benign 0.01
R5664:Pnpla6 UTSW 8 3537478 missense probably damaging 0.98
R6063:Pnpla6 UTSW 8 3524156 missense probably benign 0.21
R6314:Pnpla6 UTSW 8 3521572 missense probably benign 0.39
R6321:Pnpla6 UTSW 8 3544015 missense probably benign
R6454:Pnpla6 UTSW 8 3537986 missense probably damaging 0.99
R6477:Pnpla6 UTSW 8 3536627 missense probably benign 0.00
R6524:Pnpla6 UTSW 8 3534519 splice site probably null
R6809:Pnpla6 UTSW 8 3534611 missense possibly damaging 0.72
R6975:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7293:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7389:Pnpla6 UTSW 8 3543981 nonsense probably null
R7520:Pnpla6 UTSW 8 3537508 missense probably damaging 1.00
R7666:Pnpla6 UTSW 8 3541591 missense probably benign 0.01
R7733:Pnpla6 UTSW 8 3522660 missense probably benign 0.01
X0018:Pnpla6 UTSW 8 3517337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATTGCCATCGACGTTGG -3'
(R):5'- ATCAATTTCAGTTGATGTGGGC -3'

Sequencing Primer
(F):5'- CATCGACGTTGGAAGCCAG -3'
(R):5'- ACCTGTGGCAGACATTACTAGCTG -3'
Posted On2015-02-05