Incidental Mutation 'R3079:Prl6a1'
ID265351
Institutional Source Beutler Lab
Gene Symbol Prl6a1
Ensembl Gene ENSMUSG00000069259
Gene Nameprolactin family 6, subfamily a, member 1
SynonymsPLP-B, Prlpb
MMRRC Submission 040569-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3079 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location27312627-27319252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27319000 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 193 (D193G)
Ref Sequence ENSEMBL: ENSMUSP00000089269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091679] [ENSMUST00000091680]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091679
AA Change: D198G

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000089268
Gene: ENSMUSG00000069259
AA Change: D198G

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Hormone_1 21 235 8e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000091680
AA Change: D193G

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000089269
Gene: ENSMUSG00000069259
AA Change: D193G

DomainStartEndE-ValueType
Pfam:Hormone_1 16 230 1.1e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119758
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A T 15: 102,340,444 L168H probably damaging Het
Abca15 T C 7: 120,385,169 W1158R probably damaging Het
AI481877 G T 4: 59,047,848 T1257N possibly damaging Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Aqp11 A T 7: 97,737,588 C134S probably benign Het
Arhgap35 A G 7: 16,562,576 Y855H probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Cit A G 5: 115,925,486 D462G probably damaging Het
Col6a6 T C 9: 105,754,223 R1494G probably benign Het
Edc4 T C 8: 105,885,118 S109P possibly damaging Het
Elp4 T C 2: 105,809,445 K130E possibly damaging Het
Gemin5 A T 11: 58,145,519 V666E probably damaging Het
Gm13128 T G 4: 144,331,528 L235R probably damaging Het
Hba-x A G 11: 32,277,616 D62G probably damaging Het
Hnrnpul1 A T 7: 25,733,115 Y474* probably null Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Mrc2 T C 11: 105,336,713 S591P probably damaging Het
Msh5 T C 17: 35,046,232 E48G probably benign Het
Mybpc2 T C 7: 44,506,081 D916G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nlrp1b T C 11: 71,217,968 R236G probably benign Het
Obsl1 G T 1: 75,490,823 R1436S probably damaging Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr576 C T 7: 102,973,047 probably null Het
Padi2 T C 4: 140,949,878 V659A probably damaging Het
Pnpla6 T G 8: 3,541,512 S1169A probably benign Het
Pqlc2 G T 4: 139,306,518 A30D probably damaging Het
Rce1 G T 19: 4,624,722 C138* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint2 A G 4: 112,639,673 T259A probably benign Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Slfn1 T C 11: 83,121,160 V34A probably benign Het
Syt4 A G 18: 31,441,685 V293A probably benign Het
Trh T C 6: 92,242,570 E255G possibly damaging Het
Ube4a G T 9: 44,960,073 N9K probably damaging Het
Uck1 A T 2: 32,258,077 probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Wbp2 C T 11: 116,079,708 probably null Het
Zdbf2 A G 1: 63,307,477 I1672V probably benign Het
Other mutations in Prl6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Prl6a1 APN 13 27316364 missense possibly damaging 0.72
IGL01688:Prl6a1 APN 13 27317986 missense probably damaging 1.00
IGL01922:Prl6a1 APN 13 27315360 missense possibly damaging 0.57
IGL02059:Prl6a1 APN 13 27315365 missense probably benign 0.02
IGL03170:Prl6a1 APN 13 27315423 missense possibly damaging 0.95
R0027:Prl6a1 UTSW 13 27318028 missense probably damaging 1.00
R0027:Prl6a1 UTSW 13 27318028 missense probably damaging 1.00
R0049:Prl6a1 UTSW 13 27317997 missense probably damaging 0.99
R0606:Prl6a1 UTSW 13 27314194 intron probably benign
R0944:Prl6a1 UTSW 13 27318166 splice site probably benign
R1518:Prl6a1 UTSW 13 27318927 missense possibly damaging 0.72
R1518:Prl6a1 UTSW 13 27318928 missense probably null 0.19
R1566:Prl6a1 UTSW 13 27315427 missense possibly damaging 0.84
R1621:Prl6a1 UTSW 13 27318010 missense probably benign 0.01
R2011:Prl6a1 UTSW 13 27315369 missense probably benign 0.00
R2058:Prl6a1 UTSW 13 27319098 missense probably benign 0.05
R2937:Prl6a1 UTSW 13 27315320 missense probably damaging 0.98
R4685:Prl6a1 UTSW 13 27316324 missense probably benign 0.00
R4856:Prl6a1 UTSW 13 27319000 missense probably damaging 0.98
R4886:Prl6a1 UTSW 13 27319000 missense probably damaging 0.98
R5495:Prl6a1 UTSW 13 27312671 missense possibly damaging 0.95
R5923:Prl6a1 UTSW 13 27316363 missense probably benign 0.08
R6772:Prl6a1 UTSW 13 27319048 missense probably damaging 1.00
R7411:Prl6a1 UTSW 13 27318142 missense probably damaging 1.00
R7501:Prl6a1 UTSW 13 27316299 missense possibly damaging 0.69
R7549:Prl6a1 UTSW 13 27318971 missense probably damaging 0.96
R7563:Prl6a1 UTSW 13 27314238 critical splice donor site probably null
R7773:Prl6a1 UTSW 13 27318142 missense probably damaging 1.00
R8024:Prl6a1 UTSW 13 27318695 intron probably benign
Z1177:Prl6a1 UTSW 13 27315321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCACACTACTTTGGCATAGAGAC -3'
(R):5'- GTATTACAGGGTGAAATGAGATGTC -3'

Sequencing Primer
(F):5'- CATCCCAAGAGTTCTTTCAA -3'
(R):5'- AGACATCAACATGTTTAAAGAGTCTG -3'
Posted On2015-02-05