Incidental Mutation 'R3079:Vmn2r91'
ID265355
Institutional Source Beutler Lab
Gene Symbol Vmn2r91
Ensembl Gene ENSMUSG00000091206
Gene Namevomeronasal 2, receptor 91
SynonymsEG665210
MMRRC Submission 040569-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3079 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location18085057-18136643 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 18135711 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172359]
Predicted Effect probably null
Transcript: ENSMUST00000172359
SMART Domains Protein: ENSMUSP00000127465
Gene: ENSMUSG00000091206

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 462 2.2e-38 PFAM
Pfam:NCD3G 510 564 6.7e-20 PFAM
Pfam:7tm_3 597 832 2.1e-53 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A T 15: 102,340,444 L168H probably damaging Het
Abca15 T C 7: 120,385,169 W1158R probably damaging Het
AI481877 G T 4: 59,047,848 T1257N possibly damaging Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Aqp11 A T 7: 97,737,588 C134S probably benign Het
Arhgap35 A G 7: 16,562,576 Y855H probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Cit A G 5: 115,925,486 D462G probably damaging Het
Col6a6 T C 9: 105,754,223 R1494G probably benign Het
Edc4 T C 8: 105,885,118 S109P possibly damaging Het
Elp4 T C 2: 105,809,445 K130E possibly damaging Het
Gemin5 A T 11: 58,145,519 V666E probably damaging Het
Gm13128 T G 4: 144,331,528 L235R probably damaging Het
Hba-x A G 11: 32,277,616 D62G probably damaging Het
Hnrnpul1 A T 7: 25,733,115 Y474* probably null Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Mrc2 T C 11: 105,336,713 S591P probably damaging Het
Msh5 T C 17: 35,046,232 E48G probably benign Het
Mybpc2 T C 7: 44,506,081 D916G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nlrp1b T C 11: 71,217,968 R236G probably benign Het
Obsl1 G T 1: 75,490,823 R1436S probably damaging Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr576 C T 7: 102,973,047 probably null Het
Padi2 T C 4: 140,949,878 V659A probably damaging Het
Pnpla6 T G 8: 3,541,512 S1169A probably benign Het
Pqlc2 G T 4: 139,306,518 A30D probably damaging Het
Prl6a1 A G 13: 27,319,000 D193G possibly damaging Het
Rce1 G T 19: 4,624,722 C138* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint2 A G 4: 112,639,673 T259A probably benign Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Slfn1 T C 11: 83,121,160 V34A probably benign Het
Syt4 A G 18: 31,441,685 V293A probably benign Het
Trh T C 6: 92,242,570 E255G possibly damaging Het
Ube4a G T 9: 44,960,073 N9K probably damaging Het
Uck1 A T 2: 32,258,077 probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Wbp2 C T 11: 116,079,708 probably null Het
Zdbf2 A G 1: 63,307,477 I1672V probably benign Het
Other mutations in Vmn2r91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Vmn2r91 APN 17 18105558 missense probably benign 0.00
IGL01121:Vmn2r91 APN 17 18136504 missense possibly damaging 0.94
IGL01464:Vmn2r91 APN 17 18107602 missense probably null 0.00
IGL02003:Vmn2r91 APN 17 18107659 missense probably benign
IGL02709:Vmn2r91 APN 17 18105449 missense possibly damaging 0.74
IGL02795:Vmn2r91 APN 17 18085277 missense probably benign 0.01
IGL02813:Vmn2r91 APN 17 18136086 missense possibly damaging 0.91
IGL02830:Vmn2r91 APN 17 18136622 missense probably benign 0.01
IGL03130:Vmn2r91 APN 17 18110111 splice site probably benign
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0393:Vmn2r91 UTSW 17 18105450 missense probably damaging 1.00
R1142:Vmn2r91 UTSW 17 18136443 missense probably damaging 1.00
R1603:Vmn2r91 UTSW 17 18106143 missense probably benign 0.04
R1992:Vmn2r91 UTSW 17 18135880 missense probably damaging 1.00
R2182:Vmn2r91 UTSW 17 18105429 missense possibly damaging 0.94
R2424:Vmn2r91 UTSW 17 18136169 nonsense probably null
R2512:Vmn2r91 UTSW 17 18135786 missense probably benign
R2885:Vmn2r91 UTSW 17 18105366 missense probably benign 0.00
R2909:Vmn2r91 UTSW 17 18136399 missense probably damaging 1.00
R3009:Vmn2r91 UTSW 17 18105455 missense probably benign 0.11
R3080:Vmn2r91 UTSW 17 18135711 splice site probably null
R3434:Vmn2r91 UTSW 17 18110108 splice site probably benign
R3723:Vmn2r91 UTSW 17 18085278 critical splice donor site probably null
R3829:Vmn2r91 UTSW 17 18105497 missense probably damaging 1.00
R3845:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R3846:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R4118:Vmn2r91 UTSW 17 18110096 missense probably damaging 1.00
R4285:Vmn2r91 UTSW 17 18135768 missense probably benign 0.00
R4729:Vmn2r91 UTSW 17 18107644 missense probably damaging 1.00
R4793:Vmn2r91 UTSW 17 18105396 missense probably damaging 1.00
R4932:Vmn2r91 UTSW 17 18136489 missense possibly damaging 0.84
R5016:Vmn2r91 UTSW 17 18110060 nonsense probably null
R5018:Vmn2r91 UTSW 17 18136438 missense probably damaging 1.00
R5605:Vmn2r91 UTSW 17 18136501 missense probably damaging 1.00
R5815:Vmn2r91 UTSW 17 18106202 missense probably benign 0.01
R6146:Vmn2r91 UTSW 17 18136256 missense probably benign 0.07
R6187:Vmn2r91 UTSW 17 18106626 missense probably benign 0.05
R6426:Vmn2r91 UTSW 17 18135603 intron probably null
R6450:Vmn2r91 UTSW 17 18085265 missense probably damaging 0.98
R6767:Vmn2r91 UTSW 17 18107545 missense probably damaging 0.98
R6986:Vmn2r91 UTSW 17 18136009 missense probably benign 0.10
R7112:Vmn2r91 UTSW 17 18105618 missense possibly damaging 0.83
R7178:Vmn2r91 UTSW 17 18136162 missense probably damaging 1.00
R7330:Vmn2r91 UTSW 17 18106167 missense probably damaging 1.00
R7368:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7380:Vmn2r91 UTSW 17 18136576 nonsense probably null
R7397:Vmn2r91 UTSW 17 18135798 missense probably benign 0.02
R7625:Vmn2r91 UTSW 17 18105431 missense probably damaging 1.00
R7739:Vmn2r91 UTSW 17 18135818 missense probably benign 0.00
R7749:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7755:Vmn2r91 UTSW 17 18110049 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CAAACGTGTGTGCTGGTAAG -3'
(R):5'- TGTCTCTGTGTTTCACAAATATGCC -3'

Sequencing Primer
(F):5'- CAAGAAATATGTAAGGATCAAGGTGC -3'
(R):5'- TGCCAATAACAAAGACAGTGAGTGC -3'
Posted On2015-02-05