Mutagenetix > Incidental Mutations

Incidental Mutation 'R3080:Nebl'

265363

Institutional Source

Beutler Lab

Gene Symbol

Nebl

Ensembl Gene

ENSMUSG00000053702

Gene Name

nebulette

Synonyms

Lnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik

MMRRC Submission

040570-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3080 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

17343909-17731464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17376651 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 738 (V738A)

Ref Sequence

ENSEMBL: ENSMUSP00000117805 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270] [ENSMUST00000177966]

Predicted Effect

probably benign
Transcript: ENSMUST00000028080

SMART Domains

Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
LIM	4	56	6.95e-14	SMART
NEBU	62	92	3.35e-8	SMART
NEBU	98	128	4.88e-10	SMART
NEBU	134	164	3.82e-3	SMART
SH3	213	270	2.12e-20	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124270
AA Change: V738A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702
AA Change: V738A

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
NEBU	30	60	1.21e-5	SMART
NEBU	65	95	5.4e-3	SMART
NEBU	102	132	4.46e-4	SMART
NEBU	139	169	1.31e-1	SMART
NEBU	173	203	5.4e-3	SMART
NEBU	207	237	2.74e-4	SMART
NEBU	245	275	1.57e0	SMART
NEBU	280	310	9.67e-1	SMART
NEBU	315	345	6.25e-8	SMART
NEBU	351	381	5.97e-5	SMART
NEBU	387	418	2.56e-4	SMART
NEBU	425	455	8.91e-4	SMART
NEBU	462	492	4.92e-6	SMART
NEBU	499	529	2.33e-7	SMART
NEBU	536	566	1.84e-5	SMART
NEBU	571	601	2.23e-4	SMART
NEBU	602	632	1.24e-2	SMART
NEBU	664	694	6.6e-7	SMART
NEBU	695	725	6.86e-5	SMART
NEBU	726	756	2.03e-7	SMART
NEBU	761	791	1.74e-6	SMART
NEBU	797	827	3.82e-3	SMART
SH3	957	1014	2.12e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124611

SMART Domains

Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
NEBU	3	33	4.88e-10	SMART
NEBU	39	69	3.82e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127912

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137253

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150194

Predicted Effect

probably benign
Transcript: ENSMUST00000177966

SMART Domains

Protein: ENSMUSP00000137567
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
NEBU	5	35	2.23e-4	SMART
NEBU	36	66	3.28e-2	SMART
NEBU	67	97	6.6e-7	SMART
NEBU	98	120	2e1	SMART

Meta Mutation Damage Score

0.2793

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amer3	T	G	1: 34,588,422	L581V	probably benign	Het
Anks4b	A	T	7: 120,181,923	D59V	probably damaging	Het
Cdc42bpb	A	G	12: 111,295,818	I75T	probably damaging	Het
Ces1c	A	C	8: 93,120,347	L93R	probably damaging	Het
Clca4a	T	A	3: 144,963,790	K333N	probably damaging	Het
Copa	G	T	1: 172,113,149	D710Y	probably damaging	Het
Cyp3a25	T	A	5: 145,998,531	I92F	probably benign	Het
Dcx	T	A	X: 143,923,270	D175V	probably damaging	Het
Fam76b	G	A	9: 13,833,162	G185D	probably benign	Het
Fam96b	G	C	8: 104,641,627	R22G	possibly damaging	Het
Fastkd5	T	C	2: 130,615,453	M406V	possibly damaging	Het
Fbn2	G	A	18: 58,149,050	S298L	probably damaging	Het
Gak	T	C	5: 108,613,602	K188E	possibly damaging	Het
Gemin2	G	A	12: 59,025,091	C230Y	probably damaging	Het
Gm5150	A	C	3: 15,990,921	S47A	possibly damaging	Het
Herc3	A	T	6: 58,856,646		probably null	Het
Hist1h3b	A	G	13: 23,752,498	H40R	possibly damaging	Het
Ighv5-6	T	A	12: 113,625,617	D81V	probably damaging	Het
Igkv13-54-1	A	G	6: 69,617,470		probably null	Het
Itgad	T	C	7: 128,185,787	I288T	possibly damaging	Het
Krt1	C	T	15: 101,846,187	G543S	unknown	Het
Ltbp3	GTA	GTATA	19: 5,756,888		probably null	Het
Map4k2	G	A	19: 6,353,188	E774K	probably damaging	Het
Mbtps1	A	G	8: 119,531,205	V431A	probably benign	Het
Mbtps1	T	C	8: 119,538,863	D315G	probably damaging	Het
Npr3	G	C	15: 11,905,149	T164R	probably benign	Het
Olfr115	T	C	17: 37,610,278	T158A	probably benign	Het
Olfr214	T	G	6: 116,557,217	V264G	probably damaging	Het
Pcdhb3	T	G	18: 37,301,482	L167R	probably damaging	Het
Pcdhb8	A	T	18: 37,356,166	E299V	probably damaging	Het
Shcbp1l	A	G	1: 153,436,037	E312G	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc1a2	T	G	2: 102,748,556	L272R	probably damaging	Het
Slc35a5	A	T	16: 45,144,395	S152T	probably benign	Het
Tas2r136	C	A	6: 132,778,009	V52L	probably damaging	Het
Tbr1	C	T	2: 61,807,291	Q65*	probably null	Het
Tro	G	A	X: 150,655,202	T153I	probably benign	Het
Vmn1r222	A	G	13: 23,232,461	M194T	possibly damaging	Het
Vmn2r1	A	G	3: 64,089,784	D287G	probably damaging	Het
Vmn2r91	T	G	17: 18,135,711		probably null	Het
Zfp35	T	A	18: 24,003,310	I237N	probably damaging	Het

Other mutations in Nebl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02146:Nebl	APN	2	17348868	missense	probably damaging	0.99
IGL02732:Nebl	APN	2	17452484	splice site	probably benign
IGL03241:Nebl	APN	2	17393164	critical splice donor site	probably null
IGL03334:Nebl	APN	2	17413711	missense	probably damaging	0.98
BB008:Nebl	UTSW	2	17376622	critical splice donor site	probably null
BB018:Nebl	UTSW	2	17376622	critical splice donor site	probably null
R0068:Nebl	UTSW	2	17434971	nonsense	probably null
R0127:Nebl	UTSW	2	17392983	missense	probably benign	0.31
R0128:Nebl	UTSW	2	17393023	missense	possibly damaging	0.65
R0130:Nebl	UTSW	2	17390926	start gained	probably benign
R0130:Nebl	UTSW	2	17393023	missense	possibly damaging	0.65
R0537:Nebl	UTSW	2	17404215	missense	possibly damaging	0.62
R0743:Nebl	UTSW	2	17411118	missense	probably benign
R0884:Nebl	UTSW	2	17411118	missense	probably benign
R1364:Nebl	UTSW	2	17393037	unclassified	probably benign
R1638:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R1711:Nebl	UTSW	2	17388754	missense	probably damaging	0.96
R1933:Nebl	UTSW	2	17375292	missense	probably damaging	0.97
R1990:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R1991:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R1992:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R2062:Nebl	UTSW	2	17397121	missense	probably benign	0.39
R2183:Nebl	UTSW	2	17404216	missense	probably damaging	0.99
R2325:Nebl	UTSW	2	17393016	missense	possibly damaging	0.79
R2679:Nebl	UTSW	2	17424591	missense	probably benign	0.03
R2877:Nebl	UTSW	2	17434929	missense	probably damaging	0.99
R2878:Nebl	UTSW	2	17434929	missense	probably damaging	0.99
R3079:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R3878:Nebl	UTSW	2	17393252	missense	possibly damaging	0.83
R3947:Nebl	UTSW	2	17378106	critical splice donor site	probably null
R4983:Nebl	UTSW	2	17375271	missense	possibly damaging	0.80
R5006:Nebl	UTSW	2	17388771	splice site	probably null
R5256:Nebl	UTSW	2	17433975	missense	probably benign	0.37
R5491:Nebl	UTSW	2	17434972	nonsense	probably null
R5533:Nebl	UTSW	2	17393268	nonsense	probably null
R5597:Nebl	UTSW	2	17378167	missense	probably benign
R5658:Nebl	UTSW	2	17348852	missense	probably damaging	1.00
R5933:Nebl	UTSW	2	17404187	missense	probably benign
R6056:Nebl	UTSW	2	17450234	missense	probably benign	0.13
R6161:Nebl	UTSW	2	17730830	missense	probably benign	0.26
R6646:Nebl	UTSW	2	17376685	missense	probably damaging	1.00
R6784:Nebl	UTSW	2	17434914	nonsense	probably null
R6935:Nebl	UTSW	2	17348826	missense	probably damaging	1.00
R7196:Nebl	UTSW	2	17452518	missense	probably damaging	1.00
R7671:Nebl	UTSW	2	17390916	nonsense	probably null
R7728:Nebl	UTSW	2	17370514	missense
R7931:Nebl	UTSW	2	17376622	critical splice donor site	probably null
R8007:Nebl	UTSW	2	17370489	missense
R8048:Nebl	UTSW	2	17424522	missense	probably benign	0.12
R8118:Nebl	UTSW	2	17379820	missense	possibly damaging	0.48
R8317:Nebl	UTSW	2	17350757	missense	possibly damaging	0.71
R8349:Nebl	UTSW	2	17413782	missense	probably damaging	0.98
R8360:Nebl	UTSW	2	17460487	missense	probably benign	0.04
R8392:Nebl	UTSW	2	17452552	missense	probably benign	0.36
R8449:Nebl	UTSW	2	17413782	missense	probably damaging	0.98
R8537:Nebl	UTSW	2	17350709	missense	probably benign	0.02
X0012:Nebl	UTSW	2	17443794	missense	probably benign	0.16
X0025:Nebl	UTSW	2	17404267	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCATGTTCAGTGAAGTACATCAG -3'
(R):5'- ATGATGCACTGGAGCCTGTC -3'

Sequencing Primer
(F):5'- TGAGTCATTGCTTAAACAAACTAGAG -3'
(R):5'- CCTGTCCTGGTGAGTGAGAAGAG -3'

Posted On

2015-02-05