Incidental Mutation 'R3080:Fastkd5'
ID265366
Institutional Source Beutler Lab
Gene Symbol Fastkd5
Ensembl Gene ENSMUSG00000079043
Gene NameFAST kinase domains 5
Synonyms
MMRRC Submission 040570-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.717) question?
Stock #R3080 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130613840-130630027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130615453 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 406 (M406V)
Ref Sequence ENSEMBL: ENSMUSP00000137385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028761] [ENSMUST00000110262] [ENSMUST00000140581] [ENSMUST00000179273]
Predicted Effect probably benign
Transcript: ENSMUST00000028761
SMART Domains Protein: ENSMUSP00000028761
Gene: ENSMUSG00000027300

DomainStartEndE-ValueType
Ubox 262 331 4.47e-15 SMART
low complexity region 371 395 N/A INTRINSIC
RING 481 525 3.14e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110262
AA Change: M406V

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105891
Gene: ENSMUSG00000079043
AA Change: M406V

DomainStartEndE-ValueType
Pfam:FAST_1 475 544 6e-22 PFAM
Pfam:FAST_2 555 646 7.2e-25 PFAM
RAP 742 801 6.92e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140581
AA Change: M406V

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114878
Gene: ENSMUSG00000027300
AA Change: M406V

DomainStartEndE-ValueType
Pfam:FAST_1 474 546 2.6e-27 PFAM
Pfam:FAST_2 553 598 2.1e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179273
AA Change: M406V

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137385
Gene: ENSMUSG00000079043
AA Change: M406V

DomainStartEndE-ValueType
Pfam:FAST_1 474 546 1.5e-26 PFAM
Pfam:FAST_2 553 646 4.4e-29 PFAM
RAP 742 801 6.92e-14 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 T G 1: 34,588,422 L581V probably benign Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Cdc42bpb A G 12: 111,295,818 I75T probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Clca4a T A 3: 144,963,790 K333N probably damaging Het
Copa G T 1: 172,113,149 D710Y probably damaging Het
Cyp3a25 T A 5: 145,998,531 I92F probably benign Het
Dcx T A X: 143,923,270 D175V probably damaging Het
Fam76b G A 9: 13,833,162 G185D probably benign Het
Fam96b G C 8: 104,641,627 R22G possibly damaging Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Gak T C 5: 108,613,602 K188E possibly damaging Het
Gemin2 G A 12: 59,025,091 C230Y probably damaging Het
Gm5150 A C 3: 15,990,921 S47A possibly damaging Het
Herc3 A T 6: 58,856,646 probably null Het
Hist1h3b A G 13: 23,752,498 H40R possibly damaging Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Igkv13-54-1 A G 6: 69,617,470 probably null Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Ltbp3 GTA GTATA 19: 5,756,888 probably null Het
Map4k2 G A 19: 6,353,188 E774K probably damaging Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr214 T G 6: 116,557,217 V264G probably damaging Het
Pcdhb3 T G 18: 37,301,482 L167R probably damaging Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Shcbp1l A G 1: 153,436,037 E312G possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc1a2 T G 2: 102,748,556 L272R probably damaging Het
Slc35a5 A T 16: 45,144,395 S152T probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tbr1 C T 2: 61,807,291 Q65* probably null Het
Tro G A X: 150,655,202 T153I probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r1 A G 3: 64,089,784 D287G probably damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Zfp35 T A 18: 24,003,310 I237N probably damaging Het
Other mutations in Fastkd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Fastkd5 APN 2 130616377 missense probably benign 0.14
IGL01148:Fastkd5 APN 2 130614685 missense probably benign
IGL01765:Fastkd5 APN 2 130615734 missense possibly damaging 0.95
IGL01806:Fastkd5 APN 2 130615612 missense probably benign 0.02
IGL02266:Fastkd5 APN 2 130615561 missense probably damaging 1.00
IGL02879:Fastkd5 APN 2 130614421 missense probably damaging 0.97
R0504:Fastkd5 UTSW 2 130615917 missense probably benign 0.08
R0544:Fastkd5 UTSW 2 130615296 missense probably damaging 1.00
R1140:Fastkd5 UTSW 2 130616215 missense probably benign 0.00
R1459:Fastkd5 UTSW 2 130614797 missense probably damaging 0.97
R1770:Fastkd5 UTSW 2 130614280 missense probably damaging 1.00
R2519:Fastkd5 UTSW 2 130616194 missense possibly damaging 0.56
R2566:Fastkd5 UTSW 2 130616365 missense probably benign 0.00
R4496:Fastkd5 UTSW 2 130616581 missense probably benign 0.01
R5566:Fastkd5 UTSW 2 130614301 missense possibly damaging 0.88
R6516:Fastkd5 UTSW 2 130614301 missense possibly damaging 0.88
R6993:Fastkd5 UTSW 2 130616539 missense probably benign
R7032:Fastkd5 UTSW 2 130615944 missense possibly damaging 0.92
R7049:Fastkd5 UTSW 2 130615511 missense probably damaging 1.00
R7051:Fastkd5 UTSW 2 130614417 missense probably damaging 1.00
R7331:Fastkd5 UTSW 2 130615727 missense possibly damaging 0.79
R7348:Fastkd5 UTSW 2 130615135 missense probably damaging 1.00
R7348:Fastkd5 UTSW 2 130616439 missense probably benign 0.00
R7524:Fastkd5 UTSW 2 130616128 missense probably benign 0.41
R7603:Fastkd5 UTSW 2 130615041 missense possibly damaging 0.95
R7657:Fastkd5 UTSW 2 130616256 missense probably benign 0.00
R7745:Fastkd5 UTSW 2 130615068 missense probably damaging 1.00
R7912:Fastkd5 UTSW 2 130616637 missense probably damaging 0.97
R7993:Fastkd5 UTSW 2 130616637 missense probably damaging 0.97
X0018:Fastkd5 UTSW 2 130616612 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TTACTTCGACAGTGTGCTACCC -3'
(R):5'- CACAGGACCTGATGCAAAGACTAG -3'

Sequencing Primer
(F):5'- CTACCCTCGGAGGCAAAGAG -3'
(R):5'- CTGATGCAAAGACTAGAATCACTG -3'
Posted On2015-02-05