Incidental Mutation 'R3080:Clca4a'
ID 265371
Institutional Source Beutler Lab
Gene Symbol Clca4a
Ensembl Gene ENSMUSG00000068547
Gene Name chloride channel accessory 4A
Synonyms Clca6, 9130020L07Rik
MMRRC Submission 040570-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock # R3080 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 144952480-144975045 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144963790 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 333 (K333N)
Ref Sequence ENSEMBL: ENSMUSP00000029923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029923]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029923
AA Change: K333N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029923
Gene: ENSMUSG00000068547
AA Change: K333N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 286 300 N/A INTRINSIC
VWA 306 480 5.94e-16 SMART
Blast:VWA 513 552 7e-18 BLAST
Blast:FN3 757 838 8e-33 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 T G 1: 34,588,422 L581V probably benign Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Cdc42bpb A G 12: 111,295,818 I75T probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Copa G T 1: 172,113,149 D710Y probably damaging Het
Cyp3a25 T A 5: 145,998,531 I92F probably benign Het
Dcx T A X: 143,923,270 D175V probably damaging Het
Fam76b G A 9: 13,833,162 G185D probably benign Het
Fam96b G C 8: 104,641,627 R22G possibly damaging Het
Fastkd5 T C 2: 130,615,453 M406V possibly damaging Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Gak T C 5: 108,613,602 K188E possibly damaging Het
Gemin2 G A 12: 59,025,091 C230Y probably damaging Het
Gm5150 A C 3: 15,990,921 S47A possibly damaging Het
Herc3 A T 6: 58,856,646 probably null Het
Hist1h3b A G 13: 23,752,498 H40R possibly damaging Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Igkv13-54-1 A G 6: 69,617,470 probably null Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Ltbp3 GTA GTATA 19: 5,756,888 probably null Het
Map4k2 G A 19: 6,353,188 E774K probably damaging Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr214 T G 6: 116,557,217 V264G probably damaging Het
Pcdhb3 T G 18: 37,301,482 L167R probably damaging Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Shcbp1l A G 1: 153,436,037 E312G possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc1a2 T G 2: 102,748,556 L272R probably damaging Het
Slc35a5 A T 16: 45,144,395 S152T probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tbr1 C T 2: 61,807,291 Q65* probably null Het
Tro G A X: 150,655,202 T153I probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r1 A G 3: 64,089,784 D287G probably damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Zfp35 T A 18: 24,003,310 I237N probably damaging Het
Other mutations in Clca4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Clca4a APN 3 144954939 missense probably damaging 0.99
IGL01139:Clca4a APN 3 144966269 missense probably damaging 0.99
IGL01371:Clca4a APN 3 144960672 missense probably damaging 1.00
IGL01609:Clca4a APN 3 144953780 missense probably damaging 1.00
IGL01998:Clca4a APN 3 144958126 missense probably damaging 0.98
IGL02172:Clca4a APN 3 144970394 nonsense probably null
IGL02217:Clca4a APN 3 144961996 missense possibly damaging 0.61
IGL02514:Clca4a APN 3 144955071 missense probably damaging 1.00
IGL02975:Clca4a APN 3 144963769 missense possibly damaging 0.90
IGL03025:Clca4a APN 3 144957318 missense probably benign 0.07
IGL03049:Clca4a APN 3 144970755 splice site probably benign
IGL03058:Clca4a APN 3 144961834 splice site probably benign
IGL03259:Clca4a APN 3 144958080 missense probably damaging 1.00
IGL03263:Clca4a APN 3 144966431 missense probably damaging 1.00
IGL03334:Clca4a APN 3 144953866 missense probably benign 0.28
PIT4142001:Clca4a UTSW 3 144968311 missense probably damaging 1.00
R0201:Clca4a UTSW 3 144960717 missense probably benign 0.00
R0316:Clca4a UTSW 3 144953764 missense probably damaging 1.00
R0524:Clca4a UTSW 3 144969393 missense probably damaging 1.00
R0680:Clca4a UTSW 3 144969367 missense probably damaging 1.00
R0688:Clca4a UTSW 3 144961974 missense probably damaging 1.00
R1137:Clca4a UTSW 3 144970685 missense probably damaging 1.00
R1568:Clca4a UTSW 3 144952929 missense probably benign 0.00
R1719:Clca4a UTSW 3 144963755 missense probably damaging 1.00
R2055:Clca4a UTSW 3 144970728 missense probably damaging 1.00
R3078:Clca4a UTSW 3 144968253 missense probably damaging 0.99
R3789:Clca4a UTSW 3 144974956 missense probably damaging 1.00
R3881:Clca4a UTSW 3 144957318 missense probably benign 0.07
R4133:Clca4a UTSW 3 144969352 missense probably benign 0.07
R4402:Clca4a UTSW 3 144952848 missense probably benign 0.08
R4455:Clca4a UTSW 3 144957259 missense probably damaging 1.00
R4577:Clca4a UTSW 3 144954969 missense probably damaging 0.97
R4683:Clca4a UTSW 3 144954940 missense probably damaging 1.00
R5135:Clca4a UTSW 3 144954946 missense probably damaging 1.00
R5267:Clca4a UTSW 3 144953812 missense probably damaging 1.00
R5345:Clca4a UTSW 3 144970461 missense probably damaging 1.00
R6311:Clca4a UTSW 3 144966413 missense probably damaging 0.99
R6492:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6493:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6494:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6861:Clca4a UTSW 3 144970655 missense probably benign
R7102:Clca4a UTSW 3 144961909 missense probably benign 0.01
R7133:Clca4a UTSW 3 144961890 nonsense probably null
R7171:Clca4a UTSW 3 144958173 missense probably benign
R7516:Clca4a UTSW 3 144966248 missense probably damaging 1.00
R7642:Clca4a UTSW 3 144953751 missense probably benign 0.11
R7731:Clca4a UTSW 3 144952785 missense probably benign 0.02
R7787:Clca4a UTSW 3 144953833 missense probably benign
R7820:Clca4a UTSW 3 144960671 missense probably damaging 1.00
R7895:Clca4a UTSW 3 144968405 missense probably benign 0.19
R7991:Clca4a UTSW 3 144952739 missense possibly damaging 0.75
R8240:Clca4a UTSW 3 144970727 missense probably damaging 1.00
R9308:Clca4a UTSW 3 144970422 missense probably damaging 1.00
R9373:Clca4a UTSW 3 144966372 missense possibly damaging 0.66
R9488:Clca4a UTSW 3 144953771 missense probably damaging 1.00
R9772:Clca4a UTSW 3 144970661 missense probably damaging 1.00
R9781:Clca4a UTSW 3 144961952 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGATTCCAGAGCAGATGGACG -3'
(R):5'- CATGTGCCCCATGTTACCTATAAC -3'

Sequencing Primer
(F):5'- AGATGGACGTCCCTCCATTG -3'
(R):5'- GAAATCTGCTCTCATCTTCC -3'
Posted On 2015-02-05