Incidental Mutation 'R3080:Igkv13-54-1'
ID265378
Institutional Source Beutler Lab
Gene Symbol Igkv13-54-1
Ensembl Gene ENSMUSG00000105301
Gene Nameimmunoglobulin kappa chain variable 13-54-1
Synonyms
MMRRC Submission 040570-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R3080 (G1)
Quality Score90
Status Not validated
Chromosome6
Chromosomal Location69617048-69617423 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 69617470 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect probably null
Transcript: ENSMUST00000114209
SMART Domains Protein: ENSMUSP00000109847
Gene: ENSMUSG00000079542

DomainStartEndE-ValueType
PDB:3NFS|L 1 52 2e-11 PDB
SCOP:d1nfdb1 1 65 3e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196495
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 T G 1: 34,588,422 L581V probably benign Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Cdc42bpb A G 12: 111,295,818 I75T probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Clca4a T A 3: 144,963,790 K333N probably damaging Het
Copa G T 1: 172,113,149 D710Y probably damaging Het
Cyp3a25 T A 5: 145,998,531 I92F probably benign Het
Dcx T A X: 143,923,270 D175V probably damaging Het
Fam76b G A 9: 13,833,162 G185D probably benign Het
Fam96b G C 8: 104,641,627 R22G possibly damaging Het
Fastkd5 T C 2: 130,615,453 M406V possibly damaging Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Gak T C 5: 108,613,602 K188E possibly damaging Het
Gemin2 G A 12: 59,025,091 C230Y probably damaging Het
Gm5150 A C 3: 15,990,921 S47A possibly damaging Het
Herc3 A T 6: 58,856,646 probably null Het
Hist1h3b A G 13: 23,752,498 H40R possibly damaging Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Ltbp3 GTA GTATA 19: 5,756,888 probably null Het
Map4k2 G A 19: 6,353,188 E774K probably damaging Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr214 T G 6: 116,557,217 V264G probably damaging Het
Pcdhb3 T G 18: 37,301,482 L167R probably damaging Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Shcbp1l A G 1: 153,436,037 E312G possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc1a2 T G 2: 102,748,556 L272R probably damaging Het
Slc35a5 A T 16: 45,144,395 S152T probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tbr1 C T 2: 61,807,291 Q65* probably null Het
Tro G A X: 150,655,202 T153I probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r1 A G 3: 64,089,784 D287G probably damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Zfp35 T A 18: 24,003,310 I237N probably damaging Het
Other mutations in Igkv13-54-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02373:Igkv13-54-1 APN 6 69617320 exon noncoding transcript
IGL02944:Igkv13-54-1 APN 6 69617390 exon noncoding transcript
R1832:Igkv13-54-1 UTSW 6 69617293 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AGGTGACCTAATCCCCATCC -3'
(R):5'- TTCAGCCTGGACATCACAATCTC -3'

Sequencing Primer
(F):5'- CCATCCTATTCAACTGCATATGTAG -3'
(R):5'- GCCTGGACATCACAATCTCATATTC -3'
Posted On2015-02-05