Incidental Mutation 'R3080:Tas2r136'
ID265381
Institutional Source Beutler Lab
Gene Symbol Tas2r136
Ensembl Gene ENSMUSG00000053217
Gene Nametaste receptor, type 2, member 136
SynonymsTas2r36, mt2r52
MMRRC Submission 040570-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R3080 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132777179-132778162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 132778009 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 52 (V52L)
Ref Sequence ENSEMBL: ENSMUSP00000070791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065532]
Predicted Effect probably damaging
Transcript: ENSMUST00000065532
AA Change: V52L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070791
Gene: ENSMUSG00000053217
AA Change: V52L

DomainStartEndE-ValueType
Pfam:TAS2R 23 317 8.4e-68 PFAM
Meta Mutation Damage Score 0.5148 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TAS2R44 belongs to the large TAS2R receptor family. TAS2Rs are expressed on the surface of taste receptor cells and mediate the perception of bitterness through a G protein-coupled second messenger pathway (Conte et al., 2002 [PubMed 12584440]). For further information on TAS2Rs, see MIM 604791.[supplied by OMIM, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 T G 1: 34,588,422 L581V probably benign Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Cdc42bpb A G 12: 111,295,818 I75T probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Clca4a T A 3: 144,963,790 K333N probably damaging Het
Copa G T 1: 172,113,149 D710Y probably damaging Het
Cyp3a25 T A 5: 145,998,531 I92F probably benign Het
Dcx T A X: 143,923,270 D175V probably damaging Het
Fam76b G A 9: 13,833,162 G185D probably benign Het
Fam96b G C 8: 104,641,627 R22G possibly damaging Het
Fastkd5 T C 2: 130,615,453 M406V possibly damaging Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Gak T C 5: 108,613,602 K188E possibly damaging Het
Gemin2 G A 12: 59,025,091 C230Y probably damaging Het
Gm5150 A C 3: 15,990,921 S47A possibly damaging Het
Herc3 A T 6: 58,856,646 probably null Het
Hist1h3b A G 13: 23,752,498 H40R possibly damaging Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Igkv13-54-1 A G 6: 69,617,470 probably null Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Ltbp3 GTA GTATA 19: 5,756,888 probably null Het
Map4k2 G A 19: 6,353,188 E774K probably damaging Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr214 T G 6: 116,557,217 V264G probably damaging Het
Pcdhb3 T G 18: 37,301,482 L167R probably damaging Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Shcbp1l A G 1: 153,436,037 E312G possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc1a2 T G 2: 102,748,556 L272R probably damaging Het
Slc35a5 A T 16: 45,144,395 S152T probably benign Het
Tbr1 C T 2: 61,807,291 Q65* probably null Het
Tro G A X: 150,655,202 T153I probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r1 A G 3: 64,089,784 D287G probably damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Zfp35 T A 18: 24,003,310 I237N probably damaging Het
Other mutations in Tas2r136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Tas2r136 APN 6 132777198 missense probably damaging 1.00
IGL02414:Tas2r136 APN 6 132777531 missense possibly damaging 0.87
IGL02662:Tas2r136 APN 6 132777708 missense probably damaging 1.00
R0607:Tas2r136 UTSW 6 132777412 missense probably benign 0.09
R0785:Tas2r136 UTSW 6 132777927 missense probably benign
R1727:Tas2r136 UTSW 6 132777790 missense possibly damaging 0.63
R2101:Tas2r136 UTSW 6 132777532 missense probably benign 0.09
R2975:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R3746:Tas2r136 UTSW 6 132777237 missense probably damaging 0.97
R3749:Tas2r136 UTSW 6 132777237 missense probably damaging 0.97
R3750:Tas2r136 UTSW 6 132777237 missense probably damaging 0.97
R4362:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R4411:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R4413:Tas2r136 UTSW 6 132778009 missense probably damaging 1.00
R4803:Tas2r136 UTSW 6 132777492 missense probably damaging 1.00
R5283:Tas2r136 UTSW 6 132777411 missense probably damaging 0.99
R5343:Tas2r136 UTSW 6 132778080 missense probably benign 0.00
R5738:Tas2r136 UTSW 6 132777744 missense probably damaging 1.00
R5872:Tas2r136 UTSW 6 132777331 missense possibly damaging 0.46
R6770:Tas2r136 UTSW 6 132777382 missense probably benign 0.03
R7326:Tas2r136 UTSW 6 132777906 missense possibly damaging 0.65
R7845:Tas2r136 UTSW 6 132777870 missense probably benign 0.05
R7900:Tas2r136 UTSW 6 132777636 missense possibly damaging 0.93
R7928:Tas2r136 UTSW 6 132777870 missense probably benign 0.05
R7983:Tas2r136 UTSW 6 132777636 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATGCTGAGTATATTTGCAAGCCATG -3'
(R):5'- AATGAAGACCACATGAATCAGTGTG -3'

Sequencing Primer
(F):5'- GGTTGGTTACTATCCAGACAACAC -3'
(R):5'- CAGTGTGTTCATGAAATCACAGCC -3'
Posted On2015-02-05