Incidental Mutation 'R3080:Ces1c'
ID265384
Institutional Source Beutler Lab
Gene Symbol Ces1c
Ensembl Gene ENSMUSG00000057400
Gene Namecarboxylesterase 1C
SynonymsEs-4, Ces-N, Es1, Es-N, Ee-1, Es-1
MMRRC Submission 040570-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3080 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93099015-93131283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 93120347 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 93 (L93R)
Ref Sequence ENSEMBL: ENSMUSP00000148619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034189] [ENSMUST00000211843]
Predicted Effect probably damaging
Transcript: ENSMUST00000034189
AA Change: L239R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034189
Gene: ENSMUSG00000057400
AA Change: L239R

DomainStartEndE-ValueType
Pfam:COesterase 1 534 4e-167 PFAM
Pfam:Abhydrolase_3 136 235 6.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134161
AA Change: L93R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123146
Gene: ENSMUSG00000057400
AA Change: L93R

DomainStartEndE-ValueType
Pfam:Abhydrolase_3 1 140 3.2e-7 PFAM
Pfam:COesterase 1 177 4.9e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211843
AA Change: L93R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212091
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection against nerve agents such as chlorpyrifos and chlorpyrifos oxon but increased sensitivity to soman coumarin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 T G 1: 34,588,422 L581V probably benign Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Cdc42bpb A G 12: 111,295,818 I75T probably damaging Het
Clca4a T A 3: 144,963,790 K333N probably damaging Het
Copa G T 1: 172,113,149 D710Y probably damaging Het
Cyp3a25 T A 5: 145,998,531 I92F probably benign Het
Dcx T A X: 143,923,270 D175V probably damaging Het
Fam76b G A 9: 13,833,162 G185D probably benign Het
Fam96b G C 8: 104,641,627 R22G possibly damaging Het
Fastkd5 T C 2: 130,615,453 M406V possibly damaging Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Gak T C 5: 108,613,602 K188E possibly damaging Het
Gemin2 G A 12: 59,025,091 C230Y probably damaging Het
Gm5150 A C 3: 15,990,921 S47A possibly damaging Het
Herc3 A T 6: 58,856,646 probably null Het
Hist1h3b A G 13: 23,752,498 H40R possibly damaging Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Igkv13-54-1 A G 6: 69,617,470 probably null Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Ltbp3 GTA GTATA 19: 5,756,888 probably null Het
Map4k2 G A 19: 6,353,188 E774K probably damaging Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr214 T G 6: 116,557,217 V264G probably damaging Het
Pcdhb3 T G 18: 37,301,482 L167R probably damaging Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Shcbp1l A G 1: 153,436,037 E312G possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc1a2 T G 2: 102,748,556 L272R probably damaging Het
Slc35a5 A T 16: 45,144,395 S152T probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tbr1 C T 2: 61,807,291 Q65* probably null Het
Tro G A X: 150,655,202 T153I probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r1 A G 3: 64,089,784 D287G probably damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Zfp35 T A 18: 24,003,310 I237N probably damaging Het
Other mutations in Ces1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Ces1c APN 8 93106673 missense probably benign 0.02
IGL00558:Ces1c APN 8 93099271 missense probably benign 0.03
IGL00787:Ces1c APN 8 93120366 missense possibly damaging 0.90
IGL00851:Ces1c APN 8 93123117 missense probably benign 0.00
IGL01598:Ces1c APN 8 93118413 missense probably benign
IGL02616:Ces1c APN 8 93106615 missense probably benign 0.01
IGL03087:Ces1c APN 8 93118414 missense probably benign
IGL03203:Ces1c APN 8 93124588 missense probably damaging 1.00
R0119:Ces1c UTSW 8 93106717 unclassified probably benign
R0119:Ces1c UTSW 8 93107610 missense probably benign 0.00
R0255:Ces1c UTSW 8 93127524 missense probably benign
R0759:Ces1c UTSW 8 93130864 nonsense probably null
R1499:Ces1c UTSW 8 93127605 missense probably benign 0.01
R1926:Ces1c UTSW 8 93127604 missense possibly damaging 0.69
R2087:Ces1c UTSW 8 93107602 missense probably benign 0.00
R2142:Ces1c UTSW 8 93130840 missense probably benign
R2442:Ces1c UTSW 8 93123212 missense probably damaging 1.00
R2971:Ces1c UTSW 8 93104193 missense probably benign 0.01
R3079:Ces1c UTSW 8 93120347 missense probably damaging 1.00
R3609:Ces1c UTSW 8 93120332 missense probably damaging 1.00
R4131:Ces1c UTSW 8 93100684 missense probably damaging 1.00
R4633:Ces1c UTSW 8 93118386 missense probably benign 0.00
R4988:Ces1c UTSW 8 93100708 missense probably damaging 1.00
R5081:Ces1c UTSW 8 93127569 missense probably damaging 1.00
R5497:Ces1c UTSW 8 93130715 missense possibly damaging 0.91
R5586:Ces1c UTSW 8 93127599 missense probably benign 0.00
R7013:Ces1c UTSW 8 93130764 missense probably damaging 1.00
R7137:Ces1c UTSW 8 93130842 missense probably benign 0.02
R7611:Ces1c UTSW 8 93124511 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGAGTATTTCAGCTGCACCC -3'
(R):5'- TGGACAGGCTGCTAGTCAAG -3'

Sequencing Primer
(F):5'- GTATTTCAGCTGCACCCCACAATC -3'
(R):5'- GAATGCAGCTGCCATTAGACATCTTC -3'
Posted On2015-02-05