Incidental Mutation 'R3080:Gemin2'
ID265390
Institutional Source Beutler Lab
Gene Symbol Gemin2
Ensembl Gene ENSMUSG00000060121
Gene Namegem nuclear organelle associated protein 2
Synonyms1700012N19Rik, Sip1
MMRRC Submission 040570-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3080 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location59013393-59028470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59025091 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 230 (C230Y)
Ref Sequence ENSEMBL: ENSMUSP00000021379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021379]
Predicted Effect probably damaging
Transcript: ENSMUST00000021379
AA Change: C230Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021379
Gene: ENSMUSG00000060121
AA Change: C230Y

DomainStartEndE-ValueType
Pfam:SIP1 22 262 4e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182710
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes one of the proteins found in the survival of motor neuron (SMN) complex, which consists of the SMN protein and several gemin proteins. The SMN complex is localized to a subnuclear compartment called gems (gemini of coiled bodies) and is required for assembly of spliceosomal small nuclear ribonucleoproteins (snRNP) and for pre-mRNA splicing. This protein interacts directly with the SMN protein and it is required for formation of the SMN complex. Disruption of this gene in mouse resulted in impaired snRNP assembly, and motor neuron degeneration. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 T G 1: 34,588,422 L581V probably benign Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Cdc42bpb A G 12: 111,295,818 I75T probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Clca4a T A 3: 144,963,790 K333N probably damaging Het
Copa G T 1: 172,113,149 D710Y probably damaging Het
Cyp3a25 T A 5: 145,998,531 I92F probably benign Het
Dcx T A X: 143,923,270 D175V probably damaging Het
Fam76b G A 9: 13,833,162 G185D probably benign Het
Fam96b G C 8: 104,641,627 R22G possibly damaging Het
Fastkd5 T C 2: 130,615,453 M406V possibly damaging Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Gak T C 5: 108,613,602 K188E possibly damaging Het
Gm5150 A C 3: 15,990,921 S47A possibly damaging Het
Herc3 A T 6: 58,856,646 probably null Het
Hist1h3b A G 13: 23,752,498 H40R possibly damaging Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Igkv13-54-1 A G 6: 69,617,470 probably null Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Ltbp3 GTA GTATA 19: 5,756,888 probably null Het
Map4k2 G A 19: 6,353,188 E774K probably damaging Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr214 T G 6: 116,557,217 V264G probably damaging Het
Pcdhb3 T G 18: 37,301,482 L167R probably damaging Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Shcbp1l A G 1: 153,436,037 E312G possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc1a2 T G 2: 102,748,556 L272R probably damaging Het
Slc35a5 A T 16: 45,144,395 S152T probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tbr1 C T 2: 61,807,291 Q65* probably null Het
Tro G A X: 150,655,202 T153I probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r1 A G 3: 64,089,784 D287G probably damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Zfp35 T A 18: 24,003,310 I237N probably damaging Het
Other mutations in Gemin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Gemin2 APN 12 59021737 critical splice donor site probably null
IGL02376:Gemin2 APN 12 59021720 missense probably benign
IGL02394:Gemin2 APN 12 59014056 critical splice donor site probably null
IGL03093:Gemin2 APN 12 59021725 missense probably benign 0.01
IGL03238:Gemin2 APN 12 59016962 splice site probably benign
R0462:Gemin2 UTSW 12 59013519 missense probably damaging 0.96
R1385:Gemin2 UTSW 12 59018146 intron probably null
R4957:Gemin2 UTSW 12 59017168 missense probably benign 0.03
R6187:Gemin2 UTSW 12 59013585 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAGGTAACACCATCGAGC -3'
(R):5'- GGAGAGAAACAAACTTCATTGTCC -3'

Sequencing Primer
(F):5'- CAGGTAACACCATCGAGCATGTAG -3'
(R):5'- TGAATTACAGTCATGTGCCACC -3'
Posted On2015-02-05