Incidental Mutation 'R3080:Cdc42bpb'
ID265391
Institutional Source Beutler Lab
Gene Symbol Cdc42bpb
Ensembl Gene ENSMUSG00000021279
Gene NameCDC42 binding protein kinase beta
SynonymsDMPK-like
MMRRC Submission 040570-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R3080 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location111292976-111377718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111295818 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 75 (I75T)
Ref Sequence ENSEMBL: ENSMUSP00000152591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041965] [ENSMUST00000220657]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041965
AA Change: I1585T

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000042565
Gene: ENSMUSG00000021279
AA Change: I1585T

DomainStartEndE-ValueType
S_TKc 76 342 1e-87 SMART
S_TK_X 343 405 5.02e-10 SMART
Pfam:KELK 527 606 4.5e-32 PFAM
low complexity region 628 640 N/A INTRINSIC
coiled coil region 727 815 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Pfam:DMPK_coil 878 939 1.2e-29 PFAM
C1 1027 1076 1.43e-11 SMART
PH 1097 1217 1.19e-6 SMART
CNH 1240 1521 1.32e-10 SMART
low complexity region 1564 1576 N/A INTRINSIC
PBD 1585 1620 7.16e-10 SMART
low complexity region 1681 1696 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220619
Predicted Effect probably damaging
Transcript: ENSMUST00000220657
AA Change: I75T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222483
Predicted Effect probably benign
Transcript: ENSMUST00000222724
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein contains a Cdc42/Rac-binding p21 binding domain resembling that of PAK kinase. The kinase domain of this protein is most closely related to that of myotonic dystrophy kinase-related ROK. Studies of the similar gene in rat suggested that this kinase may act as a downstream effector of Cdc42 in cytoskeletal reorganization. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 T G 1: 34,588,422 L581V probably benign Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Clca4a T A 3: 144,963,790 K333N probably damaging Het
Copa G T 1: 172,113,149 D710Y probably damaging Het
Cyp3a25 T A 5: 145,998,531 I92F probably benign Het
Dcx T A X: 143,923,270 D175V probably damaging Het
Fam76b G A 9: 13,833,162 G185D probably benign Het
Fam96b G C 8: 104,641,627 R22G possibly damaging Het
Fastkd5 T C 2: 130,615,453 M406V possibly damaging Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Gak T C 5: 108,613,602 K188E possibly damaging Het
Gemin2 G A 12: 59,025,091 C230Y probably damaging Het
Gm5150 A C 3: 15,990,921 S47A possibly damaging Het
Herc3 A T 6: 58,856,646 probably null Het
Hist1h3b A G 13: 23,752,498 H40R possibly damaging Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Igkv13-54-1 A G 6: 69,617,470 probably null Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Ltbp3 GTA GTATA 19: 5,756,888 probably null Het
Map4k2 G A 19: 6,353,188 E774K probably damaging Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr214 T G 6: 116,557,217 V264G probably damaging Het
Pcdhb3 T G 18: 37,301,482 L167R probably damaging Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Shcbp1l A G 1: 153,436,037 E312G possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc1a2 T G 2: 102,748,556 L272R probably damaging Het
Slc35a5 A T 16: 45,144,395 S152T probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tbr1 C T 2: 61,807,291 Q65* probably null Het
Tro G A X: 150,655,202 T153I probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r1 A G 3: 64,089,784 D287G probably damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Zfp35 T A 18: 24,003,310 I237N probably damaging Het
Other mutations in Cdc42bpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Cdc42bpb APN 12 111294096 unclassified probably benign
IGL01360:Cdc42bpb APN 12 111342075 missense probably damaging 1.00
IGL01577:Cdc42bpb APN 12 111302043 missense possibly damaging 0.71
IGL01909:Cdc42bpb APN 12 111323142 missense probably benign
IGL01924:Cdc42bpb APN 12 111317453 unclassified probably benign
IGL02428:Cdc42bpb APN 12 111323127 missense probably benign
IGL02678:Cdc42bpb APN 12 111326096 missense probably damaging 1.00
IGL02792:Cdc42bpb APN 12 111299561 missense probably benign
IGL03367:Cdc42bpb APN 12 111336159 missense probably damaging 1.00
F5770:Cdc42bpb UTSW 12 111296391 missense probably benign 0.28
PIT4585001:Cdc42bpb UTSW 12 111304978 missense probably damaging 1.00
R0129:Cdc42bpb UTSW 12 111304959 intron probably benign
R0633:Cdc42bpb UTSW 12 111345555 missense probably damaging 0.99
R1054:Cdc42bpb UTSW 12 111313353 missense probably benign 0.00
R1335:Cdc42bpb UTSW 12 111296441 missense probably damaging 1.00
R1459:Cdc42bpb UTSW 12 111296300 unclassified probably benign
R1780:Cdc42bpb UTSW 12 111322907 missense probably damaging 1.00
R1823:Cdc42bpb UTSW 12 111327559 missense probably damaging 1.00
R1843:Cdc42bpb UTSW 12 111322821 missense probably benign
R1902:Cdc42bpb UTSW 12 111326016 missense probably damaging 1.00
R1945:Cdc42bpb UTSW 12 111299133 missense probably damaging 1.00
R2077:Cdc42bpb UTSW 12 111299196 missense probably damaging 1.00
R2184:Cdc42bpb UTSW 12 111296044 missense probably damaging 0.99
R2208:Cdc42bpb UTSW 12 111336029 missense probably damaging 1.00
R2211:Cdc42bpb UTSW 12 111301854 missense probably benign 0.11
R2273:Cdc42bpb UTSW 12 111302167 missense probably damaging 1.00
R2406:Cdc42bpb UTSW 12 111302124 missense probably benign 0.00
R3612:Cdc42bpb UTSW 12 111303822 intron probably benign
R4106:Cdc42bpb UTSW 12 111295145 missense probably benign 0.01
R4133:Cdc42bpb UTSW 12 111321542 missense probably benign 0.00
R4156:Cdc42bpb UTSW 12 111294139 missense probably benign 0.17
R4202:Cdc42bpb UTSW 12 111294139 missense probably benign 0.17
R4573:Cdc42bpb UTSW 12 111323141 missense probably benign 0.00
R4659:Cdc42bpb UTSW 12 111339891 missense probably damaging 1.00
R5101:Cdc42bpb UTSW 12 111299115 missense probably damaging 1.00
R5591:Cdc42bpb UTSW 12 111323087 missense probably benign 0.01
R5669:Cdc42bpb UTSW 12 111302013 critical splice donor site probably null
R5830:Cdc42bpb UTSW 12 111345582 nonsense probably null
R5872:Cdc42bpb UTSW 12 111325976 missense probably damaging 1.00
R6748:Cdc42bpb UTSW 12 111294839 unclassified probably benign
R6813:Cdc42bpb UTSW 12 111327615 missense probably damaging 1.00
R7024:Cdc42bpb UTSW 12 111326085 missense probably damaging 1.00
R7165:Cdc42bpb UTSW 12 111321517 missense probably damaging 1.00
R7228:Cdc42bpb UTSW 12 111305093 missense possibly damaging 0.92
R7258:Cdc42bpb UTSW 12 111326084 missense probably damaging 1.00
R7352:Cdc42bpb UTSW 12 111299311 missense probably damaging 1.00
R7361:Cdc42bpb UTSW 12 111345605 missense probably damaging 1.00
R7399:Cdc42bpb UTSW 12 111305667 missense probably benign 0.00
R7468:Cdc42bpb UTSW 12 111339873 missense probably damaging 1.00
R7622:Cdc42bpb UTSW 12 111294772 missense unknown
R7648:Cdc42bpb UTSW 12 111377153 missense probably damaging 1.00
R7734:Cdc42bpb UTSW 12 111329230 missense probably damaging 1.00
R7783:Cdc42bpb UTSW 12 111336025 critical splice donor site probably null
V7582:Cdc42bpb UTSW 12 111296391 missense probably benign 0.28
V7583:Cdc42bpb UTSW 12 111296391 missense probably benign 0.28
X0023:Cdc42bpb UTSW 12 111326078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCATCACTTGACTGAGTC -3'
(R):5'- AACGACGTTTTGTCTTCAAGGTTC -3'

Sequencing Primer
(F):5'- ATCACTTGACTGAGTCCCACG -3'
(R):5'- TCTTCAAGGTTCCCGAGGAAG -3'
Posted On2015-02-05