Incidental Mutation 'R3080:Vmn1r222'
ID265393
Institutional Source Beutler Lab
Gene Symbol Vmn1r222
Ensembl Gene ENSMUSG00000061022
Gene Namevomeronasal 1 receptor 222
SynonymsV1rh16
MMRRC Submission 040570-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R3080 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23232066-23233119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23232461 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 194 (M194T)
Ref Sequence ENSEMBL: ENSMUSP00000076365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077116]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077116
AA Change: M194T

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076365
Gene: ENSMUSG00000061022
AA Change: M194T

DomainStartEndE-ValueType
Pfam:V1R 32 297 3.6e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225143
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 T G 1: 34,588,422 L581V probably benign Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Cdc42bpb A G 12: 111,295,818 I75T probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Clca4a T A 3: 144,963,790 K333N probably damaging Het
Copa G T 1: 172,113,149 D710Y probably damaging Het
Cyp3a25 T A 5: 145,998,531 I92F probably benign Het
Dcx T A X: 143,923,270 D175V probably damaging Het
Fam76b G A 9: 13,833,162 G185D probably benign Het
Fam96b G C 8: 104,641,627 R22G possibly damaging Het
Fastkd5 T C 2: 130,615,453 M406V possibly damaging Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Gak T C 5: 108,613,602 K188E possibly damaging Het
Gemin2 G A 12: 59,025,091 C230Y probably damaging Het
Gm5150 A C 3: 15,990,921 S47A possibly damaging Het
Herc3 A T 6: 58,856,646 probably null Het
Hist1h3b A G 13: 23,752,498 H40R possibly damaging Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Igkv13-54-1 A G 6: 69,617,470 probably null Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Ltbp3 GTA GTATA 19: 5,756,888 probably null Het
Map4k2 G A 19: 6,353,188 E774K probably damaging Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr214 T G 6: 116,557,217 V264G probably damaging Het
Pcdhb3 T G 18: 37,301,482 L167R probably damaging Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Shcbp1l A G 1: 153,436,037 E312G possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc1a2 T G 2: 102,748,556 L272R probably damaging Het
Slc35a5 A T 16: 45,144,395 S152T probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tbr1 C T 2: 61,807,291 Q65* probably null Het
Tro G A X: 150,655,202 T153I probably benign Het
Vmn2r1 A G 3: 64,089,784 D287G probably damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Zfp35 T A 18: 24,003,310 I237N probably damaging Het
Other mutations in Vmn1r222
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Vmn1r222 APN 13 23232889 missense probably benign 0.45
IGL01960:Vmn1r222 APN 13 23232145 missense probably benign 0.00
IGL02082:Vmn1r222 APN 13 23232329 missense probably damaging 1.00
IGL02616:Vmn1r222 APN 13 23232141 missense possibly damaging 0.73
IGL03155:Vmn1r222 APN 13 23232693 missense probably damaging 1.00
IGL03333:Vmn1r222 APN 13 23233007 missense probably benign 0.18
IGL03391:Vmn1r222 APN 13 23232462 missense possibly damaging 0.94
R0137:Vmn1r222 UTSW 13 23232804 missense probably damaging 1.00
R1584:Vmn1r222 UTSW 13 23232762 missense probably damaging 1.00
R2352:Vmn1r222 UTSW 13 23232513 missense probably benign 0.35
R3079:Vmn1r222 UTSW 13 23232461 missense possibly damaging 0.75
R3963:Vmn1r222 UTSW 13 23232932 missense probably benign 0.01
R4448:Vmn1r222 UTSW 13 23232293 missense probably benign 0.11
R4448:Vmn1r222 UTSW 13 23232660 missense probably damaging 0.99
R4979:Vmn1r222 UTSW 13 23232432 missense possibly damaging 0.78
R5054:Vmn1r222 UTSW 13 23232731 missense probably damaging 0.98
R5182:Vmn1r222 UTSW 13 23232497 missense probably damaging 1.00
R5230:Vmn1r222 UTSW 13 23233002 missense probably benign
R5462:Vmn1r222 UTSW 13 23232875 missense probably benign 0.05
R5611:Vmn1r222 UTSW 13 23232573 missense probably damaging 1.00
R5677:Vmn1r222 UTSW 13 23232780 missense probably damaging 1.00
R6298:Vmn1r222 UTSW 13 23232795 missense probably benign 0.15
R6655:Vmn1r222 UTSW 13 23232716 missense probably damaging 1.00
R6748:Vmn1r222 UTSW 13 23232947 missense probably benign 0.00
R6912:Vmn1r222 UTSW 13 23232204 missense probably benign 0.44
R7663:Vmn1r222 UTSW 13 23232431 missense possibly damaging 0.78
R7764:Vmn1r222 UTSW 13 23232359 missense probably damaging 1.00
Z1177:Vmn1r222 UTSW 13 23232460 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AACCAAGGGTCAGAAACTCATG -3'
(R):5'- AGGCCAAAGTATGCATGGC -3'

Sequencing Primer
(F):5'- GGGTCAGAAACTCATGAATATTTACC -3'
(R):5'- CTTGTCATTCTTTTGGGTACTCAATG -3'
Posted On2015-02-05