Incidental Mutation 'R3080:Slc35a5'
ID265397
Institutional Source Beutler Lab
Gene Symbol Slc35a5
Ensembl Gene ENSMUSG00000022664
Gene Namesolute carrier family 35, member A5
Synonyms1010001J06Rik, D730043G07Rik, D16Ertd450e
MMRRC Submission 040570-MU
Accession Numbers

Genbank: NM_028756; MGI: 1921352

Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R3080 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location45139573-45158706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45144395 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 152 (S152T)
Ref Sequence ENSEMBL: ENSMUSP00000110247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023344] [ENSMUST00000114600] [ENSMUST00000180636] [ENSMUST00000181177]
Predicted Effect probably benign
Transcript: ENSMUST00000023344
AA Change: H158Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000023344
Gene: ENSMUSG00000022664
AA Change: H158Q

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 28 387 1.3e-54 PFAM
low complexity region 424 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114600
AA Change: S152T

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110247
Gene: ENSMUSG00000022664
AA Change: S152T

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Nuc_sug_transp 107 155 1.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152364
Predicted Effect probably benign
Transcript: ENSMUST00000180636
AA Change: H158Q

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000137821
Gene: ENSMUSG00000022664
AA Change: H158Q

DomainStartEndE-ValueType
Pfam:UAA 30 196 5.2e-8 PFAM
Pfam:TPT 31 177 3.3e-7 PFAM
Pfam:EamA 73 179 1.2e-7 PFAM
Pfam:Nuc_sug_transp 91 222 7.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181177
SMART Domains Protein: ENSMUSP00000137789
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 30 94 1.1e-12 PFAM
low complexity region 139 152 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein which belongs to subfamily 35A of the solute carrier superfamily. The encoded protein is a nucleoside-sugar transporter. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI

 All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 T G 1: 34,588,422 L581V probably benign Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Cdc42bpb A G 12: 111,295,818 I75T probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Clca4a T A 3: 144,963,790 K333N probably damaging Het
Copa G T 1: 172,113,149 D710Y probably damaging Het
Cyp3a25 T A 5: 145,998,531 I92F probably benign Het
Dcx T A X: 143,923,270 D175V probably damaging Het
Fam76b G A 9: 13,833,162 G185D probably benign Het
Fam96b G C 8: 104,641,627 R22G possibly damaging Het
Fastkd5 T C 2: 130,615,453 M406V possibly damaging Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Gak T C 5: 108,613,602 K188E possibly damaging Het
Gemin2 G A 12: 59,025,091 C230Y probably damaging Het
Gm5150 A C 3: 15,990,921 S47A possibly damaging Het
Herc3 A T 6: 58,856,646 probably null Het
Hist1h3b A G 13: 23,752,498 H40R possibly damaging Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Igkv13-54-1 A G 6: 69,617,470 probably null Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Ltbp3 GTA GTATA 19: 5,756,888 probably null Het
Map4k2 G A 19: 6,353,188 E774K probably damaging Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr214 T G 6: 116,557,217 V264G probably damaging Het
Pcdhb3 T G 18: 37,301,482 L167R probably damaging Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Shcbp1l A G 1: 153,436,037 E312G possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc1a2 T G 2: 102,748,556 L272R probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tbr1 C T 2: 61,807,291 Q65* probably null Het
Tro G A X: 150,655,202 T153I probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r1 A G 3: 64,089,784 D287G probably damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Zfp35 T A 18: 24,003,310 I237N probably damaging Het
Other mutations in Slc35a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc35a5 APN 16 45152608 nonsense probably null
IGL01012:Slc35a5 APN 16 45143832 missense probably damaging 1.00
IGL01396:Slc35a5 APN 16 45151503 missense probably damaging 1.00
IGL03293:Slc35a5 APN 16 45143781 missense probably damaging 1.00
3-1:Slc35a5 UTSW 16 45143892 missense probably damaging 0.99
R1532:Slc35a5 UTSW 16 45151557 missense probably benign 0.03
R1561:Slc35a5 UTSW 16 45151521 missense possibly damaging 0.93
R1864:Slc35a5 UTSW 16 45143708 missense possibly damaging 0.66
R2086:Slc35a5 UTSW 16 45144265 missense probably damaging 0.99
R2887:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R2888:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R2889:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R2890:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R3434:Slc35a5 UTSW 16 45144033 missense probably benign 0.23
R3720:Slc35a5 UTSW 16 45147322 missense probably damaging 0.99
R3722:Slc35a5 UTSW 16 45147322 missense probably damaging 0.99
R3916:Slc35a5 UTSW 16 45158158 intron probably benign
R3917:Slc35a5 UTSW 16 45158158 intron probably benign
R4616:Slc35a5 UTSW 16 45144292 missense probably benign 0.12
R6648:Slc35a5 UTSW 16 45143917 missense probably damaging 1.00
R6881:Slc35a5 UTSW 16 45144080 missense possibly damaging 0.83
R7730:Slc35a5 UTSW 16 45143883 missense probably damaging 0.97
R7832:Slc35a5 UTSW 16 45144207 missense possibly damaging 0.76
R7915:Slc35a5 UTSW 16 45144207 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCCACTGGACTTCACTGAAAGTC -3'
(R):5'- ATGCGAGACACAGTCCTGTC -3'

Sequencing Primer
(F):5'- TGGACTTCACTGAAAGTCCACTC -3'
(R):5'- GACACAGTCCTGTCAAGTTATAGTGC -3'
Posted On2015-02-05