Incidental Mutation 'R3080:Olfr115'
ID265399
Institutional Source Beutler Lab
Gene Symbol Olfr115
Ensembl Gene ENSMUSG00000092413
Gene Nameolfactory receptor 115
SynonymsGA_x6K02T2PSCP-2070203-2069271, MOR218-11P
MMRRC Submission 040570-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R3080 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37608940-37627109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37610278 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 158 (T158A)
Ref Sequence ENSEMBL: ENSMUSP00000152714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076936] [ENSMUST00000221552] [ENSMUST00000223366]
Predicted Effect probably benign
Transcript: ENSMUST00000076936
AA Change: T160A

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000076203
Gene: ENSMUSG00000092413
AA Change: T160A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 24 252 2.6e-7 PFAM
Pfam:7tm_4 31 308 3.2e-45 PFAM
Pfam:7tm_1 41 290 2.3e-21 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000133907
Gene: ENSMUSG00000092413
AA Change: T158A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.2e-46 PFAM
Pfam:7TM_GPCR_Srx 32 307 2.9e-9 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.4e-8 PFAM
Pfam:7tm_1 41 290 5.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194511
AA Change: T160A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202918
AA Change: T160A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207850
Predicted Effect probably benign
Transcript: ENSMUST00000221552
AA Change: T158A

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000223366
AA Change: T158A

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 T G 1: 34,588,422 L581V probably benign Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Cdc42bpb A G 12: 111,295,818 I75T probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Clca4a T A 3: 144,963,790 K333N probably damaging Het
Copa G T 1: 172,113,149 D710Y probably damaging Het
Cyp3a25 T A 5: 145,998,531 I92F probably benign Het
Dcx T A X: 143,923,270 D175V probably damaging Het
Fam76b G A 9: 13,833,162 G185D probably benign Het
Fam96b G C 8: 104,641,627 R22G possibly damaging Het
Fastkd5 T C 2: 130,615,453 M406V possibly damaging Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Gak T C 5: 108,613,602 K188E possibly damaging Het
Gemin2 G A 12: 59,025,091 C230Y probably damaging Het
Gm5150 A C 3: 15,990,921 S47A possibly damaging Het
Herc3 A T 6: 58,856,646 probably null Het
Hist1h3b A G 13: 23,752,498 H40R possibly damaging Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Igkv13-54-1 A G 6: 69,617,470 probably null Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Ltbp3 GTA GTATA 19: 5,756,888 probably null Het
Map4k2 G A 19: 6,353,188 E774K probably damaging Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr214 T G 6: 116,557,217 V264G probably damaging Het
Pcdhb3 T G 18: 37,301,482 L167R probably damaging Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Shcbp1l A G 1: 153,436,037 E312G possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc1a2 T G 2: 102,748,556 L272R probably damaging Het
Slc35a5 A T 16: 45,144,395 S152T probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tbr1 C T 2: 61,807,291 Q65* probably null Het
Tro G A X: 150,655,202 T153I probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r1 A G 3: 64,089,784 D287G probably damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Zfp35 T A 18: 24,003,310 I237N probably damaging Het
Other mutations in Olfr115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Olfr115 APN 17 37623661 intron probably benign
R1132:Olfr115 UTSW 17 37610442 missense possibly damaging 0.90
R1829:Olfr115 UTSW 17 37610277 missense probably benign 0.04
R1831:Olfr115 UTSW 17 37609839 missense possibly damaging 0.92
R1872:Olfr115 UTSW 17 37609912 missense probably damaging 1.00
R2140:Olfr115 UTSW 17 37610471 missense probably benign
R2142:Olfr115 UTSW 17 37610471 missense probably benign
R3079:Olfr115 UTSW 17 37610278 missense probably benign 0.07
R5250:Olfr115 UTSW 17 37609960 missense probably damaging 0.99
R5539:Olfr115 UTSW 17 37610755 start codon destroyed probably benign 0.00
R5586:Olfr115 UTSW 17 37610254 missense probably damaging 1.00
R5921:Olfr115 UTSW 17 37610219 nonsense probably null
R6469:Olfr115 UTSW 17 37610313 missense probably damaging 1.00
R6473:Olfr115 UTSW 17 37609996 missense possibly damaging 0.46
R6754:Olfr115 UTSW 17 37610155 missense probably benign
R7457:Olfr115 UTSW 17 37610565 missense possibly damaging 0.60
R7736:Olfr115 UTSW 17 37610412 missense probably damaging 1.00
R7814:Olfr115 UTSW 17 37610656 missense probably benign 0.04
Z1177:Olfr115 UTSW 17 37610053 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCATCCTGAGAACTGTGGAG -3'
(R):5'- TTCTTATGAACAGTGCATGCTG -3'

Sequencing Primer
(F):5'- TCCTGAGAACTGTGGAGAATATGTG -3'
(R):5'- ATGCTGCAGATTCTTTTCTTTACATG -3'
Posted On2015-02-05