Incidental Mutation 'R3080:Dcx'
ID265406
Institutional Source Beutler Lab
Gene Symbol Dcx
Ensembl Gene ENSMUSG00000031285
Gene Namedoublecortin
SynonymsDbct, lissencephaly, X-linked (doublecortin)
MMRRC Submission 040570-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.579) question?
Stock #R3080 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location143855842-143933311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143923270 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 175 (D175V)
Ref Sequence ENSEMBL: ENSMUSP00000108477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033642] [ENSMUST00000087313] [ENSMUST00000112851] [ENSMUST00000112856]
Predicted Effect probably damaging
Transcript: ENSMUST00000033642
AA Change: D175V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033642
Gene: ENSMUSG00000031285
AA Change: D175V

DomainStartEndE-ValueType
DCX 48 139 3.09e-48 SMART
DCX 175 263 2.69e-39 SMART
low complexity region 349 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087313
AA Change: D175V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084570
Gene: ENSMUSG00000031285
AA Change: D175V

DomainStartEndE-ValueType
DCX 48 139 3.09e-48 SMART
DCX 175 263 2.69e-39 SMART
low complexity region 349 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112851
AA Change: D175V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108472
Gene: ENSMUSG00000031285
AA Change: D175V

DomainStartEndE-ValueType
DCX 48 139 3.09e-48 SMART
DCX 175 263 2.69e-39 SMART
low complexity region 348 364 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112856
AA Change: D175V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108477
Gene: ENSMUSG00000031285
AA Change: D175V

DomainStartEndE-ValueType
DCX 48 139 3.09e-48 SMART
DCX 175 263 2.69e-39 SMART
low complexity region 343 359 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139920
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach the site of their final differentiation. The encoded protein appears to direct neuronal migration by regulating the organization and stability of microtubules. In addition, the encoded protein interacts with LIS1, the regulatory gamma subunit of platelet activating factor acetylhydrolase. Studies in knockout mice lacking this gene and the LIS1 gene suggest that the molecular interaction of these two genes is important in both in neuronal migration and neurogenesis, and there is a cortical role of this gene in nuclear translocation and positioning of the mitotic spindle in radial glial mitotic division. Multiple transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Males hemizygous for a null allele are fertile but show branching and nucleokinesis defects in migrating interneurons. Males hemizygous for a reporter allele show severe postnatal lethality and variable fertility; both female and male mutants display hippocampal dyslamination and behavioral defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 T G 1: 34,588,422 L581V probably benign Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Cdc42bpb A G 12: 111,295,818 I75T probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Clca4a T A 3: 144,963,790 K333N probably damaging Het
Copa G T 1: 172,113,149 D710Y probably damaging Het
Cyp3a25 T A 5: 145,998,531 I92F probably benign Het
Fam76b G A 9: 13,833,162 G185D probably benign Het
Fam96b G C 8: 104,641,627 R22G possibly damaging Het
Fastkd5 T C 2: 130,615,453 M406V possibly damaging Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Gak T C 5: 108,613,602 K188E possibly damaging Het
Gemin2 G A 12: 59,025,091 C230Y probably damaging Het
Gm5150 A C 3: 15,990,921 S47A possibly damaging Het
Herc3 A T 6: 58,856,646 probably null Het
Hist1h3b A G 13: 23,752,498 H40R possibly damaging Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Igkv13-54-1 A G 6: 69,617,470 probably null Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Ltbp3 GTA GTATA 19: 5,756,888 probably null Het
Map4k2 G A 19: 6,353,188 E774K probably damaging Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr214 T G 6: 116,557,217 V264G probably damaging Het
Pcdhb3 T G 18: 37,301,482 L167R probably damaging Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Shcbp1l A G 1: 153,436,037 E312G possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc1a2 T G 2: 102,748,556 L272R probably damaging Het
Slc35a5 A T 16: 45,144,395 S152T probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tbr1 C T 2: 61,807,291 Q65* probably null Het
Tro G A X: 150,655,202 T153I probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r1 A G 3: 64,089,784 D287G probably damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Zfp35 T A 18: 24,003,310 I237N probably damaging Het
Other mutations in Dcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Dcx APN X 143931154 missense possibly damaging 0.96
R1913:Dcx UTSW X 143923103 missense probably damaging 1.00
R2897:Dcx UTSW X 143923432 splice site probably benign
R3115:Dcx UTSW X 143923109 missense probably damaging 1.00
R3689:Dcx UTSW X 143877244 missense possibly damaging 0.67
R3690:Dcx UTSW X 143877244 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CCTGCTTTCCATCAAGGGTG -3'
(R):5'- CCCAAAGCCTTATTTCAGTCTG -3'

Sequencing Primer
(F):5'- CTGCTTTCCATCAAGGGTGTAGAG -3'
(R):5'- AGCATATACTTGATTTGCTTCTGC -3'
Posted On2015-02-05