Incidental Mutation 'R3081:Myo3b'
ID 265410
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 040571-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3081 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to C at 70086927 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably benign
Transcript: ENSMUST00000060208
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,214,432 (GRCm39) T48S probably benign Het
Abcc3 T A 11: 94,247,802 (GRCm39) L1230F probably damaging Het
Abcf3 T A 16: 20,378,114 (GRCm39) I542N probably benign Het
Als2 A G 1: 59,226,508 (GRCm39) L932P probably damaging Het
Arhgap45 G A 10: 79,862,281 (GRCm39) R583H probably damaging Het
Asl T C 5: 130,042,245 (GRCm39) Y277C probably damaging Het
Bcl9 A T 3: 97,112,989 (GRCm39) N1155K possibly damaging Het
Carm1 C A 9: 21,490,692 (GRCm39) probably null Het
Cdkn2aip T C 8: 48,164,532 (GRCm39) K394E probably damaging Het
Cfap70 A G 14: 20,470,830 (GRCm39) Y472H probably damaging Het
Cfap77 T A 2: 28,852,662 (GRCm39) K203N probably damaging Het
Cldn14 T C 16: 93,716,192 (GRCm39) K218R probably damaging Het
Coro6 T C 11: 77,359,738 (GRCm39) F336S probably damaging Het
Derl1 C A 15: 57,739,007 (GRCm39) probably benign Het
Dixdc1 G A 9: 50,622,259 (GRCm39) A25V probably damaging Het
Dock2 T A 11: 34,181,610 (GRCm39) H1651L probably benign Het
Dock6 A G 9: 21,750,496 (GRCm39) F473L possibly damaging Het
Dzip3 T C 16: 48,747,921 (GRCm39) H1163R probably damaging Het
Efcab9 T C 11: 32,473,689 (GRCm39) D35G probably benign Het
Evpl T C 11: 116,111,678 (GRCm39) D2004G probably damaging Het
Faiml A G 9: 99,114,527 (GRCm39) C121R probably damaging Het
Fastkd3 T C 13: 68,732,987 (GRCm39) V436A probably benign Het
Fbxl5 A G 5: 43,908,222 (GRCm39) Y660H probably damaging Het
Glt8d1 T C 14: 30,728,617 (GRCm39) V15A probably benign Het
Gpr25 A C 1: 136,187,623 (GRCm39) I330S possibly damaging Het
Hdac5 A T 11: 102,096,436 (GRCm39) V257E probably damaging Het
Lama2 C T 10: 26,877,231 (GRCm39) E2652K probably benign Het
Lrriq1 T A 10: 102,980,750 (GRCm39) S1462C probably damaging Het
Mgat3 A G 15: 80,096,055 (GRCm39) D294G probably benign Het
Mylk2 A G 2: 152,761,274 (GRCm39) N459S probably benign Het
Naip6 T C 13: 100,436,961 (GRCm39) T521A probably benign Het
Nfxl1 C T 5: 72,686,378 (GRCm39) A608T possibly damaging Het
Nmd3 A G 3: 69,631,732 (GRCm39) probably benign Het
Nol8 C T 13: 49,831,868 (GRCm39) probably benign Het
Or1e29 A T 11: 73,668,051 (GRCm39) M34K probably damaging Het
Or8b12i C A 9: 20,082,061 (GRCm39) G269W probably benign Het
Or8b42 T A 9: 38,342,352 (GRCm39) M258K possibly damaging Het
Or8g34 G A 9: 39,373,226 (GRCm39) M166I probably benign Het
Pcdhgb2 T C 18: 37,824,566 (GRCm39) F519S probably damaging Het
Phf11c A G 14: 59,618,933 (GRCm39) V284A probably benign Het
Rasl11a G T 5: 146,784,113 (GRCm39) C186F probably benign Het
Rps18-ps3 T C 8: 107,989,469 (GRCm39) noncoding transcript Het
Rusc1 A G 3: 88,999,030 (GRCm39) S251P possibly damaging Het
Rxfp3 T C 15: 11,037,303 (GRCm39) E23G probably benign Het
Senp6 G A 9: 80,051,124 (GRCm39) A1134T probably benign Het
Slc22a4 A G 11: 53,898,615 (GRCm39) V159A probably benign Het
Spata31d1a T C 13: 59,850,907 (GRCm39) N407S probably benign Het
Ssc4d T C 5: 135,994,578 (GRCm39) T51A possibly damaging Het
Stip1 C T 19: 7,013,016 (GRCm39) A23T probably benign Het
Tecta A T 9: 42,289,290 (GRCm39) M425K possibly damaging Het
Tmed4 T C 11: 6,224,151 (GRCm39) H115R probably benign Het
Tmem255b T A 8: 13,501,048 (GRCm39) L74H probably damaging Het
Trav6n-5 A T 14: 53,342,741 (GRCm39) H93L possibly damaging Het
Tsen54 T A 11: 115,710,990 (GRCm39) D187E probably benign Het
Ttc39d A G 17: 80,524,982 (GRCm39) Y547C probably damaging Het
Vmn2r88 A G 14: 51,656,089 (GRCm39) N775S probably damaging Het
Vps13a G T 19: 16,642,101 (GRCm39) N2175K probably benign Het
Wnk4 A G 11: 101,167,717 (GRCm39) probably benign Het
Zfp180 A T 7: 23,804,928 (GRCm39) Q449L probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGATCTCTAAGTCCATGTGTG -3'
(R):5'- CCTGCAAAGACTGTGGTTCC -3'

Sequencing Primer
(F):5'- CACGTGCAGCAAATACGGTTTTC -3'
(R):5'- CAAAGACTGTGGTTCCTGTCAG -3'
Posted On 2015-02-05