Incidental Mutation 'R3081:Spata31d1a'
ID265450
Institutional Source Beutler Lab
Gene Symbol Spata31d1a
Ensembl Gene ENSMUSG00000050876
Gene Namespermatogenesis associated 31 subfamily D, member 1A
Synonyms
MMRRC Submission 040571-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3081 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location59699806-59710330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59703093 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 407 (N407S)
Ref Sequence ENSEMBL: ENSMUSP00000152919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066510] [ENSMUST00000224469] [ENSMUST00000224982]
Predicted Effect probably benign
Transcript: ENSMUST00000066510
AA Change: N407S

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128533
Gene: ENSMUSG00000050876
AA Change: N407S

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 66 150 3.7e-25 PFAM
low complexity region 196 217 N/A INTRINSIC
low complexity region 240 266 N/A INTRINSIC
Pfam:FAM75 400 772 2.9e-108 PFAM
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224469
Predicted Effect probably benign
Transcript: ENSMUST00000224982
AA Change: N407S

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225362
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Als2 A G 1: 59,187,349 L932P probably damaging Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap70 A G 14: 20,420,762 Y472H probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Coro6 T C 11: 77,468,912 F336S probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Evpl T C 11: 116,220,852 D2004G probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fastkd3 T C 13: 68,584,868 V436A probably benign Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mgat3 A G 15: 80,211,854 D294G probably benign Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rusc1 A G 3: 89,091,723 S251P possibly damaging Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Stip1 C T 19: 7,035,648 A23T probably benign Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Vps13a G T 19: 16,664,737 N2175K probably benign Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Spata31d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Spata31d1a APN 13 59702185 missense probably benign 0.27
IGL01397:Spata31d1a APN 13 59701738 missense probably damaging 0.99
IGL01448:Spata31d1a APN 13 59701559 missense probably benign 0.06
IGL02715:Spata31d1a APN 13 59703735 missense probably benign 0.44
IGL02983:Spata31d1a APN 13 59703694 missense possibly damaging 0.65
IGL03224:Spata31d1a APN 13 59701026 missense possibly damaging 0.85
PIT1430001:Spata31d1a UTSW 13 59701196 missense probably benign
R0302:Spata31d1a UTSW 13 59703150 missense probably benign
R0387:Spata31d1a UTSW 13 59703501 missense probably damaging 0.99
R0464:Spata31d1a UTSW 13 59701759 missense possibly damaging 0.85
R0606:Spata31d1a UTSW 13 59702431 missense probably benign 0.03
R0617:Spata31d1a UTSW 13 59702259 missense possibly damaging 0.53
R0691:Spata31d1a UTSW 13 59700385 missense possibly damaging 0.93
R0746:Spata31d1a UTSW 13 59702263 missense possibly damaging 0.95
R1019:Spata31d1a UTSW 13 59702368 missense probably benign
R1397:Spata31d1a UTSW 13 59705039 splice site probably benign
R1543:Spata31d1a UTSW 13 59702242 missense probably benign
R1619:Spata31d1a UTSW 13 59702433 nonsense probably null
R1799:Spata31d1a UTSW 13 59703402 missense probably benign
R1820:Spata31d1a UTSW 13 59701255 missense possibly damaging 0.86
R1885:Spata31d1a UTSW 13 59702007 missense probably damaging 0.99
R1909:Spata31d1a UTSW 13 59702695 missense probably damaging 0.99
R2012:Spata31d1a UTSW 13 59702556 missense possibly damaging 0.93
R2099:Spata31d1a UTSW 13 59706071 missense probably damaging 0.97
R2132:Spata31d1a UTSW 13 59701043 missense probably damaging 0.96
R2224:Spata31d1a UTSW 13 59703715 missense probably benign
R2225:Spata31d1a UTSW 13 59703715 missense probably benign
R2226:Spata31d1a UTSW 13 59703715 missense probably benign
R2358:Spata31d1a UTSW 13 59703888 missense probably benign 0.00
R2495:Spata31d1a UTSW 13 59701993 missense possibly damaging 0.93
R3151:Spata31d1a UTSW 13 59701366 missense probably benign 0.06
R3971:Spata31d1a UTSW 13 59702157 missense possibly damaging 0.85
R4156:Spata31d1a UTSW 13 59705047 missense possibly damaging 0.92
R4760:Spata31d1a UTSW 13 59701645 missense probably damaging 1.00
R4767:Spata31d1a UTSW 13 59701155 missense probably benign 0.03
R4877:Spata31d1a UTSW 13 59702523 missense probably damaging 0.99
R4894:Spata31d1a UTSW 13 59701728 missense probably damaging 0.98
R4961:Spata31d1a UTSW 13 59701902 missense possibly damaging 0.86
R4990:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4991:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4992:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R5088:Spata31d1a UTSW 13 59701152 unclassified probably null
R5094:Spata31d1a UTSW 13 59705044 critical splice donor site probably null
R5330:Spata31d1a UTSW 13 59700403 missense possibly damaging 0.86
R5587:Spata31d1a UTSW 13 59702618 missense probably damaging 0.96
R5832:Spata31d1a UTSW 13 59701566 missense probably damaging 0.98
R6073:Spata31d1a UTSW 13 59702994 missense probably damaging 0.98
R6208:Spata31d1a UTSW 13 59700564 missense probably damaging 0.98
R6224:Spata31d1a UTSW 13 59706320 start gained probably benign
R6250:Spata31d1a UTSW 13 59701801 missense possibly damaging 0.93
R6359:Spata31d1a UTSW 13 59703106 missense probably benign
R6806:Spata31d1a UTSW 13 59703218 missense probably benign
R6848:Spata31d1a UTSW 13 59701963 missense possibly damaging 0.91
R6851:Spata31d1a UTSW 13 59703911 missense unknown
R6985:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R7007:Spata31d1a UTSW 13 59703634 missense probably benign
R7037:Spata31d1a UTSW 13 59700324 missense possibly damaging 0.96
R7124:Spata31d1a UTSW 13 59702487 missense probably damaging 0.99
R7271:Spata31d1a UTSW 13 59702099 missense probably benign 0.00
R7346:Spata31d1a UTSW 13 59703201 missense probably benign
R7556:Spata31d1a UTSW 13 59701984 missense probably benign 0.00
R7581:Spata31d1a UTSW 13 59704139 critical splice donor site probably null
R7891:Spata31d1a UTSW 13 59700325 missense possibly damaging 0.96
R7974:Spata31d1a UTSW 13 59700325 missense possibly damaging 0.96
R7995:Spata31d1a UTSW 13 59701110 missense probably benign 0.06
Z1177:Spata31d1a UTSW 13 59703085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGGTCACTCTCAGGCAAG -3'
(R):5'- CTCTTCACGAAGCAAGAGGAAG -3'

Sequencing Primer
(F):5'- TCACTCTCAGGCAAGGGCAG -3'
(R):5'- GCTGATGGCACTGTGTATAAAC -3'
Posted On2015-02-05