Incidental Mutation 'R3082:Ugt2a3'
ID265479
Institutional Source Beutler Lab
Gene Symbol Ugt2a3
Ensembl Gene ENSMUSG00000035780
Gene NameUDP glucuronosyltransferase 2 family, polypeptide A3
Synonyms2010321J07Rik
MMRRC Submission 040572-MU
Accession Numbers

Genbank: NM_028094; MGI: 1919344

Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3082 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87324972-87337195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87325675 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 461 (V461A)
Ref Sequence ENSEMBL: ENSMUSP00000031195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031195]
Predicted Effect probably benign
Transcript: ENSMUST00000031195
AA Change: V461A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031195
Gene: ENSMUSG00000035780
AA Change: V461A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:UDPGT 24 526 1.2e-233 PFAM
Pfam:Glyco_tran_28_C 318 454 1.5e-10 PFAM
Meta Mutation Damage Score 0.2321 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Adam11 T C 11: 102,770,117 probably benign Het
Aox2 G T 1: 58,283,600 probably benign Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Cep63 T C 9: 102,602,497 T339A probably benign Het
Clcn1 T C 6: 42,290,178 Y66H probably damaging Het
Cpsf2 C G 12: 101,988,810 S280C probably damaging Het
Dcaf6 G T 1: 165,422,852 probably benign Het
Ddx39 T A 8: 83,722,706 N344K possibly damaging Het
Dvl1 T C 4: 155,847,859 V42A possibly damaging Het
Ep400 A G 5: 110,693,230 probably benign Het
Epb41l5 C T 1: 119,609,262 V300I probably damaging Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Ints13 G T 6: 146,574,707 Q99K possibly damaging Het
L2hgdh C T 12: 69,722,084 D85N probably benign Het
Lct A G 1: 128,287,608 Y1744H probably damaging Het
Macf1 T C 4: 123,361,443 probably null Het
Mpdz A T 4: 81,285,458 probably benign Het
Naa15 T C 3: 51,460,050 L498P probably damaging Het
Naip6 T A 13: 100,316,417 E45D probably benign Het
Nedd4l T A 18: 65,178,978 N405K probably benign Het
Olfr1037 C T 2: 86,085,709 V23I probably benign Het
Olfr724 A G 14: 49,960,704 Y123H probably damaging Het
Pitpnc1 A G 11: 107,212,524 S250P possibly damaging Het
Ppp1r18 A G 17: 35,873,850 D131G probably damaging Het
Prdm5 A G 6: 65,936,085 D206G probably damaging Het
Pygl A G 12: 70,197,529 F455S probably damaging Het
Rictor A T 15: 6,774,857 Y565F probably benign Het
Ryr1 T C 7: 29,045,646 N3852D probably damaging Het
S1pr5 A T 9: 21,244,990 C47S probably damaging Het
Serpinf2 T C 11: 75,437,528 R65G probably benign Het
Slfn14 C T 11: 83,276,693 W665* probably null Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Spata18 A G 5: 73,679,080 probably benign Het
Tex19.2 A G 11: 121,116,731 V297A probably benign Het
Tmem131l A G 3: 83,909,150 probably null Het
Trim9 T C 12: 70,255,113 R584G possibly damaging Het
Trpm7 A T 2: 126,844,422 N295K possibly damaging Het
Vmn1r45 A T 6: 89,933,742 M82K probably benign Het
Other mutations in Ugt2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ugt2a3 APN 5 87325655 missense probably damaging 0.99
IGL00542:Ugt2a3 APN 5 87336823 missense possibly damaging 0.61
IGL01335:Ugt2a3 APN 5 87336785 missense probably damaging 1.00
IGL01369:Ugt2a3 APN 5 87327120 missense probably damaging 1.00
IGL01808:Ugt2a3 APN 5 87325555 missense probably benign 0.09
IGL02380:Ugt2a3 APN 5 87336799 missense probably benign 0.09
IGL03245:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03260:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03261:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03280:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03302:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
D4186:Ugt2a3 UTSW 5 87329613 missense probably damaging 1.00
R0051:Ugt2a3 UTSW 5 87337006 missense probably damaging 1.00
R0103:Ugt2a3 UTSW 5 87336718 missense possibly damaging 0.89
R0103:Ugt2a3 UTSW 5 87336718 missense possibly damaging 0.89
R0324:Ugt2a3 UTSW 5 87327073 critical splice donor site probably null
R0401:Ugt2a3 UTSW 5 87336490 missense probably benign 0.03
R0506:Ugt2a3 UTSW 5 87336649 missense possibly damaging 0.78
R0903:Ugt2a3 UTSW 5 87327711 missense probably benign 0.00
R0940:Ugt2a3 UTSW 5 87327206 missense possibly damaging 0.95
R1121:Ugt2a3 UTSW 5 87327689 missense probably damaging 0.99
R1296:Ugt2a3 UTSW 5 87327146 missense probably damaging 0.96
R1527:Ugt2a3 UTSW 5 87325598 missense probably damaging 1.00
R2104:Ugt2a3 UTSW 5 87329682 splice site probably null
R2119:Ugt2a3 UTSW 5 87336571 missense probably damaging 0.98
R2374:Ugt2a3 UTSW 5 87327191 missense probably damaging 1.00
R3853:Ugt2a3 UTSW 5 87337159 missense possibly damaging 0.74
R3894:Ugt2a3 UTSW 5 87329590 missense probably benign 0.09
R4063:Ugt2a3 UTSW 5 87336866 missense probably benign 0.04
R4274:Ugt2a3 UTSW 5 87327689 missense probably damaging 0.99
R4739:Ugt2a3 UTSW 5 87327195 missense probably damaging 0.97
R4879:Ugt2a3 UTSW 5 87331285 missense probably benign 0.06
R5327:Ugt2a3 UTSW 5 87331315 missense probably damaging 1.00
R5508:Ugt2a3 UTSW 5 87327200 missense probably damaging 0.98
R5866:Ugt2a3 UTSW 5 87336547 missense probably damaging 1.00
R6026:Ugt2a3 UTSW 5 87336477 missense probably benign 0.00
R6268:Ugt2a3 UTSW 5 87329613 missense probably damaging 1.00
R6807:Ugt2a3 UTSW 5 87336758 missense probably benign 0.00
R6980:Ugt2a3 UTSW 5 87325632 missense probably damaging 1.00
R7056:Ugt2a3 UTSW 5 87337094 missense probably damaging 0.98
R7133:Ugt2a3 UTSW 5 87325534 missense possibly damaging 0.61
R7477:Ugt2a3 UTSW 5 87336620 missense possibly damaging 0.90
R7485:Ugt2a3 UTSW 5 87327680 critical splice donor site probably null
R7798:Ugt2a3 UTSW 5 87327723 missense probably damaging 1.00
R7957:Ugt2a3 UTSW 5 87327191 missense probably damaging 1.00
R8803:Ugt2a3 UTSW 5 87336530 missense probably damaging 0.98
R8886:Ugt2a3 UTSW 5 87336499 missense probably damaging 1.00
R8944:Ugt2a3 UTSW 5 87325558 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATAATTGTCACTCAGGGCTTTCC -3'
(R):5'- GTCCTGAAGATCCCCGAAAC -3'

Sequencing Primer
(F):5'- AGACCTAGTTCTTTTTCTTTCTGTTC -3'
(R):5'- TGAAGATCCCCGAAACTAACAAAG -3'
Posted On2015-02-05