Incidental Mutation 'P4748:Akap10'
ID26548
Institutional Source Beutler Lab
Gene Symbol Akap10
Ensembl Gene ENSMUSG00000047804
Gene NameA kinase (PRKA) anchor protein 10
SynonymsB130049N18Rik, 1500031L16Rik, D-AKAP2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.793) question?
Stock #P4748 () of strain 712
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location61871307-61930252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61873020 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 662 (L662P)
Ref Sequence ENSEMBL: ENSMUSP00000099710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102650]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102650
AA Change: L662P

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099710
Gene: ENSMUSG00000047804
AA Change: L662P

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
PDB:3TMH|L 623 662 2e-18 PDB
Blast:S_TKc 636 661 1e-5 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148413
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.5%
  • 20x: 94.5%
Validation Efficiency 87% (26/30)
MGI Phenotype FUNCTION: This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is localized to mitochondria and interacts with both the type I and type II regulatory subunits of PKA. It has been reported that this protein is important for maintaining heart rate and myocardial contractility through its targeting of protein kinase A. In mouse, defects of this gene lead to cardiac arrhythmias and premature death. In humans, polymorphisms in this gene may be associated with increased risk of arrhythmias and sudden cardiac death. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele display sinus arrhythmia, sinus pauses, and atrioventricular heart block indicating excessive vagus nerve sensitivity; about 50% of homozygous and 25% of heterozygous mutant mice die in the first year of life, and survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4930556J24Rik A T 11: 3,938,178 probably null Het
Acoxl T C 2: 128,086,344 probably benign Het
Ahi1 G C 10: 20,972,110 R472S probably damaging Het
Arhgef10 C T 8: 14,928,925 T64M possibly damaging Het
Ccr4 C T 9: 114,492,838 G53D probably damaging Het
Cdc25a T C 9: 109,884,108 probably benign Het
Clec4n A C 6: 123,244,540 Q114H probably damaging Het
Cmya5 A G 13: 93,074,475 probably benign Het
Depdc1a T C 3: 159,522,547 V312A probably damaging Het
Ephb6 C T 6: 41,617,285 P583L probably damaging Het
Klra8 A T 6: 130,122,044 D185E possibly damaging Het
Meis2 T A 2: 115,864,480 Q394L probably benign Het
Olfr328 G A 11: 58,551,522 T239I probably damaging Het
Pzp C T 6: 128,490,089 G1107D probably damaging Het
Ralgapa2 C T 2: 146,346,811 W1350* probably null Het
Scand1 C A 2: 156,311,945 R135L probably damaging Het
Spopl A T 2: 23,511,443 M351K probably benign Het
Tmed4 T C 11: 6,273,727 probably benign Het
Ube2e2 A G 14: 18,630,297 probably null Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Usp51 GATGCAT GAT X: 153,008,231 probably null Het
Wrap53 A T 11: 69,562,205 D425E probably damaging Het
Other mutations in Akap10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Akap10 APN 11 61915071 missense possibly damaging 0.85
IGL00971:Akap10 APN 11 61904796 missense possibly damaging 0.68
IGL01510:Akap10 APN 11 61878020 missense possibly damaging 0.74
IGL02731:Akap10 APN 11 61893476 missense possibly damaging 0.78
IGL03289:Akap10 APN 11 61877968 splice site probably benign
IGL03294:Akap10 APN 11 61877353 missense probably damaging 1.00
IGL03403:Akap10 APN 11 61915273 missense probably benign 0.00
R0924:Akap10 UTSW 11 61904863 splice site probably benign
R1324:Akap10 UTSW 11 61915021 splice site probably null
R2117:Akap10 UTSW 11 61890303 missense possibly damaging 0.73
R2243:Akap10 UTSW 11 61915501 missense possibly damaging 0.56
R2402:Akap10 UTSW 11 61915222 missense probably benign
R2567:Akap10 UTSW 11 61893349 intron probably benign
R3745:Akap10 UTSW 11 61915305 missense probably benign
R5124:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5126:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5180:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5219:Akap10 UTSW 11 61922791 missense probably benign
R5324:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R6753:Akap10 UTSW 11 61886777 missense probably damaging 0.96
R7121:Akap10 UTSW 11 61886698 critical splice donor site probably null
R7763:Akap10 UTSW 11 61915505 missense probably damaging 1.00
R7867:Akap10 UTSW 11 61900446 missense probably damaging 1.00
R7950:Akap10 UTSW 11 61900446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAGGAAGTAATCTGCTGCGAG -3'
(R):5'- ACGATGTTCACACAAATGCACATGC -3'

Sequencing Primer
(F):5'- TGGTCTAATAAGTCGCCACC -3'
(R):5'- gcaattcccagcaaccac -3'
Posted On2013-04-16