Incidental Mutation 'R3082:Pygl'
ID265498
Institutional Source Beutler Lab
Gene Symbol Pygl
Ensembl Gene ENSMUSG00000021069
Gene Nameliver glycogen phosphorylase
Synonyms
MMRRC Submission 040572-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R3082 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location70190811-70231488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70197529 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 455 (F455S)
Ref Sequence ENSEMBL: ENSMUSP00000125585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]
Predicted Effect probably damaging
Transcript: ENSMUST00000071250
AA Change: F546S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: F546S

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161083
AA Change: F455S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: F455S

DomainStartEndE-ValueType
Pfam:Phosphorylase 21 739 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162613
Meta Mutation Damage Score 0.8495 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Adam11 T C 11: 102,770,117 probably benign Het
Aox2 G T 1: 58,283,600 probably benign Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Cep63 T C 9: 102,602,497 T339A probably benign Het
Clcn1 T C 6: 42,290,178 Y66H probably damaging Het
Cpsf2 C G 12: 101,988,810 S280C probably damaging Het
Dcaf6 G T 1: 165,422,852 probably benign Het
Ddx39 T A 8: 83,722,706 N344K possibly damaging Het
Dvl1 T C 4: 155,847,859 V42A possibly damaging Het
Ep400 A G 5: 110,693,230 probably benign Het
Epb41l5 C T 1: 119,609,262 V300I probably damaging Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Ints13 G T 6: 146,574,707 Q99K possibly damaging Het
L2hgdh C T 12: 69,722,084 D85N probably benign Het
Lct A G 1: 128,287,608 Y1744H probably damaging Het
Macf1 T C 4: 123,361,443 probably null Het
Mpdz A T 4: 81,285,458 probably benign Het
Naa15 T C 3: 51,460,050 L498P probably damaging Het
Naip6 T A 13: 100,316,417 E45D probably benign Het
Nedd4l T A 18: 65,178,978 N405K probably benign Het
Olfr1037 C T 2: 86,085,709 V23I probably benign Het
Olfr724 A G 14: 49,960,704 Y123H probably damaging Het
Pitpnc1 A G 11: 107,212,524 S250P possibly damaging Het
Ppp1r18 A G 17: 35,873,850 D131G probably damaging Het
Prdm5 A G 6: 65,936,085 D206G probably damaging Het
Rictor A T 15: 6,774,857 Y565F probably benign Het
Ryr1 T C 7: 29,045,646 N3852D probably damaging Het
S1pr5 A T 9: 21,244,990 C47S probably damaging Het
Serpinf2 T C 11: 75,437,528 R65G probably benign Het
Slfn14 C T 11: 83,276,693 W665* probably null Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Spata18 A G 5: 73,679,080 probably benign Het
Tex19.2 A G 11: 121,116,731 V297A probably benign Het
Tmem131l A G 3: 83,909,150 probably null Het
Trim9 T C 12: 70,255,113 R584G possibly damaging Het
Trpm7 A T 2: 126,844,422 N295K possibly damaging Het
Ugt2a3 A G 5: 87,325,675 V461A probably benign Het
Vmn1r45 A T 6: 89,933,742 M82K probably benign Het
Other mutations in Pygl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Pygl APN 12 70191092 missense probably damaging 1.00
IGL00903:Pygl APN 12 70207742 missense probably damaging 1.00
IGL01965:Pygl APN 12 70191114 missense probably benign 0.00
IGL02347:Pygl APN 12 70201892 missense probably benign 0.14
IGL02403:Pygl APN 12 70194258 missense probably benign
IGL02501:Pygl APN 12 70191134 missense probably benign 0.05
IGL02727:Pygl APN 12 70207668 splice site probably null
IGL03125:Pygl APN 12 70197482 missense probably damaging 1.00
IGL03158:Pygl APN 12 70195675 missense probably damaging 1.00
IGL03202:Pygl APN 12 70199646 missense probably benign
IGL03368:Pygl APN 12 70191152 missense probably benign
R0096:Pygl UTSW 12 70191166 splice site probably benign
R0096:Pygl UTSW 12 70191166 splice site probably benign
R0524:Pygl UTSW 12 70207724 missense probably damaging 1.00
R0883:Pygl UTSW 12 70206404 missense probably damaging 0.97
R0894:Pygl UTSW 12 70194374 splice site probably benign
R0905:Pygl UTSW 12 70211017 splice site probably benign
R1494:Pygl UTSW 12 70199730 missense probably damaging 0.98
R1621:Pygl UTSW 12 70191092 missense probably damaging 1.00
R1647:Pygl UTSW 12 70197010 missense possibly damaging 0.60
R3845:Pygl UTSW 12 70198443 missense probably benign 0.12
R3876:Pygl UTSW 12 70201339 missense probably damaging 1.00
R4358:Pygl UTSW 12 70195690 missense probably damaging 1.00
R4614:Pygl UTSW 12 70210979 intron probably null
R4707:Pygl UTSW 12 70207758 missense possibly damaging 0.69
R4908:Pygl UTSW 12 70197033 missense probably null
R4940:Pygl UTSW 12 70206381 missense probably damaging 1.00
R5077:Pygl UTSW 12 70201892 missense probably benign 0.14
R5186:Pygl UTSW 12 70201344 missense probably damaging 1.00
R5726:Pygl UTSW 12 70191142 nonsense probably null
R5953:Pygl UTSW 12 70219627 missense probably damaging 1.00
R5957:Pygl UTSW 12 70199720 missense probably damaging 0.99
R6020:Pygl UTSW 12 70216654 missense probably damaging 1.00
R6024:Pygl UTSW 12 70197067 missense probably benign 0.09
R7050:Pygl UTSW 12 70219622 missense probably damaging 1.00
R7159:Pygl UTSW 12 70197406 missense probably benign 0.41
R7194:Pygl UTSW 12 70194320 missense probably benign
R7283:Pygl UTSW 12 70216568 missense possibly damaging 0.92
R7360:Pygl UTSW 12 70227532 missense probably benign 0.11
R7446:Pygl UTSW 12 70197010 missense probably benign
R7637:Pygl UTSW 12 70197795 intron probably null
R7886:Pygl UTSW 12 70206356 splice site probably null
R7969:Pygl UTSW 12 70206356 splice site probably null
R8054:Pygl UTSW 12 70227339 critical splice donor site probably null
Z1176:Pygl UTSW 12 70222874 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCTTGAGACAGATGCTTCCATC -3'
(R):5'- TGAAAGACCTGAGCCAGCTG -3'

Sequencing Primer
(F):5'- GATGCTTCCATCCCCCTGAGAG -3'
(R):5'- GACGAAGCTCCACAGTTTTG -3'
Posted On2015-02-05